Bio::Seq PrimedSeq
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Toolbar
WebCvs
Summary
Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it
Package variables
No package variables defined.
Included modules
Bio::SeqFeature::Primer
Inherit
Bio::Root::Root Bio::SeqFeature::Generic
Synopsis
  use Bio::Seq;
use Bio::Seq::PrimedSeq;
my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' ); my $left = Bio::Seq->new( -seq => 'AGCT' ); my $right = Bio::Seq->new( -seq => 'GTTGC' ); my $primedseq = Bio::Seq::PrimedSeq->new( -seq => $template, # sequence object -left_primer => $left, # sequence or primer object -right_primer => $right # sequence or primer object ); # Get the primers as Bio::SeqFeature::Primer objects my @primer_objects = $primedseq->get_primer(); # Sequence object representing the PCR product, i.e. the section of the target # sequence contained between the primers (primers included) my $amplicon_seq = $primedseq->amplicon(); print 'Got amplicon sequence: '.$amplicon_seq->seq."\n"; # Amplicon should be: agctTTTCATTCTGACTgcaac
Description
This module was created to address the fact that a primer is more than a
SeqFeature and that there is a need to represent the primer-sequence complex and
the attributes that are associated with the complex.
A PrimedSeq object is initialized with a target sequence and two primers. The
location of the primers on the target sequence is calculated so that one can
then get the PCR product, or amplicon sequence. From the PrimedSeq object you
can also retrieve information about melting temperatures and what not on each
of the primers and the amplicon. The Bio::Tools::Primer3 uses PrimedSeq
objects extensively.
Note that this module does not simulate PCR. It assumes that the primers will
match in a single location on the target sequence and does not understand
degenerate primers.
The Bio::Seq::PrimedSeq was initially started by Chad Matsalla, and later
improved on by Rob Edwards.
Methods
newDescriptionCode
get_primerDescriptionCode
annotated_sequenceDescriptionCode
ampliconDescriptionCode
seqDescriptionCode
_place_primersDescriptionCode
_set_seqfeatureDescriptionCode
Methods description
newcode    nextTop
 Title   : new()
Usage : my $primedseq = Bio::SeqFeature::Primer->new(
-seq => $sequence,
-left_primer => $left_primer,
-right_primer => $right_primer
);
Function: Construct a primed sequence.
Returns : A Bio::Seq::PrimedSeq object
Args : -seq => a Bio::Seq object (required)
-left_primer => a Bio::SeqFeature::Primer or sequence object (required)
-right_primer => a Bio::SeqFeature::Primer or sequence object (required)
If you pass a sequence object to specify a primer, it will be used to construct a Bio::SeqFeature::Primer that you can retrieve with the get_primer method.
Many other parameters can be included including all of the output parameters from the primer3 program (see Bio::Tools::Primer3). At
the moment these parameters will simply be stored and do anything.
get_primercodeprevnextTop
 Title   : get_primer();
Usage : my @primers = $primedseq->get_primer();
or
my $primer = $primedseq->get_primer('-left_primer');
Function: Get the primers associated with the PrimedSeq object.
Returns : A Bio::SeqFeature::Primer object
Args : For the left primer, use: l, left, left_primer or -left_primer
For the right primer, use: r, right, right_primer or -right_primer
For both primers [default], use: b, both, both_primers or -both_primers
annotated_sequencecodeprevnextTop
 Title   : annotated_sequence
Usage : my $annotated_sequence_object = $primedseq->annotated_sequence();
Function: Get an annotated sequence object containg the left and right
primers
Returns : An annotated sequence object or 0 if not defined.
Args :
Note : Use this method to return a sequence object that you can write
out (e.g. in GenBank format). See the example above.
ampliconcodeprevnextTop
 Title   : amplicon
Usage : my $amplicon = $primedseq->amplicon();
Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
only the section of the target sequence between the primer matches
(primers included).
Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
Args : None
Note :
seqcodeprevnextTop
 Title   : seq
Usage : my $seqobj = $primedseq->seq();
Function: Retrieve the target sequence as a sequence object
Returns : A seq object. To get the sequence use $seqobj->seq
Args : None
Note :
_place_primerscodeprevnextTop
 Title   : _place_primers
Usage : $self->_place_primers();
Function: An internal method to place the primers on the sequence and
set up the ranges of the sequences
Returns : Nothing
Args : None
Note : Internal use only
_set_seqfeaturecodeprevnextTop
 Title   : _set_seqfeature
Usage : $self->_set_seqfeature()
Function: An internal method to create Bio::SeqFeature::Generic objects
for the primed seq
Returns : Nothing
Args : None
Note : Internal use only. Should only call this once left and right
primers have been placed on the sequence. This will then set
them as sequence features so hopefully we can get a nice output
with write_seq.
Methods code
newdescriptionprevnextTop
sub new {
    my($class,%args) = @_;
    my $self = $class->SUPER::new(%args);

    # Need an amplicon sequence
$self->{seq} = delete $args{-seq} || delete $args{-target_sequence} || $self->throw("Need to provide a sequence during PrimedSeq object construction"); if (! ref($self->{seq}) || ! $self->{seq}->isa('Bio::SeqI') ) { $self->throw("The target_sequence must be a Bio::Seq to create this object."); } # Need a left and right primers
for my $primer ( 'left', 'right' ) { $self->{$primer} = delete $args{'-'.$primer.'_primer'} || $self->throw("Need to provide both primers during PrimedSeq object construction"); if ( ref $self->{$primer} && $self->{$primer}->isa('Bio::PrimarySeqI') ) { # Convert Bio::Seq or Bio::PrimarySeq objects to Bio::SeqFeature::Primer
$self->{$primer} = Bio::SeqFeature::Primer->new(-seq => $self->{$primer}); } if (not (ref $self->{$primer} && $self->{$primer}->isa("Bio::SeqFeature::Primer"))) { $self->throw("Primers must be Bio::SeqFeature::Primer objects but got a ".ref($self->{$primer})); } } # Save remaining arguments
while (my ($arg, $val) = each %args) { $self->{$arg} = $val; } # Now we have the sequences, let's find out where they are
$self->_place_primers(); return $self;
}
get_primerdescriptionprevnextTop
sub get_primer {
    my ($self, $arg) = @_;
    if (! defined $arg ) {
        return ($self->{'left'}, $self->{'right'});
    } elsif ( $arg =~ /^-?l/ ) { 
        # What a cheat, I couldn't be bothered to write all the exact statements!
# Hah, now you can write 'leprechaun' to get the left primer.
return $self->{'left'} } elsif ( $arg =~ /^-?r/ ) { return $self->{'right'}; } elsif ( $arg =~ /^-?b/ ) { return ($self->{'left'}, $self->{'right'}); }
}
annotated_sequencedescriptionprevnextTop
sub annotated_sequence {
    my $self = shift;
    if (not exists $self->{annotated_sequence}) {
        $self->_set_seqfeature;
    }
    return $self->{annotated_sequence} || 0;
}
amplicondescriptionprevnextTop
sub amplicon {
    my ($self) = @_;
    my $seqobj = Bio::Seq->new(
        -id  => 'Amplicon_from_'.($self->seq->id || 'unidentified'),
        -seq => $self->{'amplicon_sequence'},
    );
    return $seqobj;
}
seqdescriptionprevnextTop
sub seq {
    my $self = shift;
    return $self->{seq};
}
_place_primersdescriptionprevnextTop
sub _place_primers {
    my $self = shift;

    # Get the target and primer sequence strings, all in uppercase
my $target_seq = uc $self->{'seq'}->seq(); my $left_seq = uc $self->{'left'}->seq()->seq(); my $right_seq = uc $self->{'right'}->seq()->revcom()->seq(); # Locate primers on target sequence
my ($before, $middle, $after) = ($target_seq =~ /^(.*)$left_seq(.*)$right_seq(.*)$/); if (not defined $before || not defined $middle || not defined $after) { if ($target_seq !~ /$left_seq/) { $self->throw("Could not place left primer on target"); } if ($target_seq !~ /$right_seq/) { $self->throw("Could not place right primer on target") } } # Bio::Seq::PrimedSeq positions
my $left_location = length($before).','.length($left_seq); my $right_location = (length($target_seq) - length($after) - 1).','.length($right_seq); my $amplicon_size = length($left_seq) + length($middle) + length($right_seq); # Primer3 positions
my $primer_left = $self->{'left'}->{'PRIMER_LEFT'}; my $primer_right = $self->{'right'}->{'PRIMER_RIGHT'}; my $primer_product_size = $self->{'PRIMER_PRODUCT_SIZE'}; # Compare Bio::Seq::PrimedSeq positions to Primer3 positions
if (defined $primer_left) { if (not $primer_left eq $left_location) { $self->warn("Note got |$primer_left| from primer3 and |$left_location| for the left primer."); } } else { $self->{'left'}->{'PRIMER_LEFT'} = $left_location; } if (defined $primer_right) { if (not $primer_right eq $right_location) { $self->warn("Note got |$primer_right| from primer3 and |$right_location| for the right primer."); } } else { $self->{'right'}->{'PRIMER_RIGHT'} = $right_location; } if (defined $primer_product_size) { if (not $primer_product_size eq $amplicon_size) { $self->warn("Note got |$primer_product_size| from primer3 and |$amplicon_size| for the size."); } } else { $self->{'PRIMER_PRODUCT_SIZE'} = $amplicon_size; } $self->{'amplicon_sequence'} = lc($left_seq).uc($middle).lc($right_seq);
}
_set_seqfeaturedescriptionprevnextTop
sub _set_seqfeature {
    my $self = shift;
    unless ($self->{'left'}->{'PRIMER_LEFT'} && 
              $self->{'right'}->{'PRIMER_RIGHT'}) {
        $self->warn('Hmmm. Haven\'t placed primers, but trying to make annotated sequence');
        return 0;
    }
    my ($start, $length) = split /,/, $self->{'left'}->{'PRIMER_LEFT'};
    my $tm = $self->{'left'}->{'PRIMER_LEFT_TM'} || $self->{'left'}->Tm || 0;

    my $seqfeatureL = Bio::SeqFeature::Generic->new(
        -start       => $start + 1,
        -end         => $start + $length,
        -strand      => 1,
        -primary_tag => 'left_primer',
        -source      => 'primer3',
        -tag         => {new => 1, author => 'Bio::Seq::PrimedSeq', Tm => $tm},
    );
 
    ($start, $length) = split /,/, $self->{'right'}->{'PRIMER_RIGHT'};
    $tm = $self->{'right'}->{'PRIMER_RIGHT_TM'} || $self->{'right'}->Tm || 0;
 
    my $seqfeatureR = Bio::SeqFeature::Generic->new(
        -start       => $start - $length + 2,
        -end         => $start + 1,
        -strand      => -1,
        -primary_tag => 'right_primer',
        -source      => 'primer3',
        -tag         => {new => 1, author => 'Bio::Seq::PrimedSeq', Tm => $tm},
    );

    # Now add the sequences to an annotated sequence
$self->{annotated_sequence} = $self->{seq}; $self->{annotated_sequence}->add_SeqFeature($seqfeatureL); $self->{annotated_sequence}->add_SeqFeature($seqfeatureR); } 1;
}
General documentation
RECIPESTop
    1.
    Run Primer3 to get PrimedSeq objects:
  use Bio::SeqIO;
use Bio::Tools::Run::Primer3;
# Read a target sequences from a FASTA file my $file = shift || die "Need a file to read"; my $seqin = Bio::SeqIO->new(-file => $file); my $seq = $seqin->next_seq; # Use Primer3 to design some primers my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq); my $results = $primer3->run; # default parameters # Write all the results in a Genbank file my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", -format => 'genbank'); while (my $primedseq = $results->next_primer) { $seqout->write_seq( $primedseq->annotated_seq ); }
    2.
    Create a genbank file for a sequence and its cognate primers:
  use Bio::SeqIO;
use Bio::Seq::PrimedSeq;
# Read a FASTA file that contains the target sequence and its two primers my $file = shift || die "$0 "; my $seqin = Bio::SeqIO->new(-file => $file); my ($template, $leftprimer, $rightprimer) = ($seqin->next_seq, $seqin->next_seq, $seqin->next_seq); # Set up a PrimedSeq object my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template, -left_primer => $leftprimer, -right_primer => $rightprimer); # Write the sequences in an output Genbank file my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", -format => 'genbank'); $seqout->write_seq($primedseq->annotated_sequence);
FEEDBACKTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support Top
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
  https://redmine.open-bio.org/projects/bioperl/
AUTHORTop
Rob Edwards, redwards@utmem.edu
Based on a module written by Chad Matsalla, bioinformatics1@dieselwurks.com
APPENDIXTop
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _