Bio::Tools::Run
StandAloneNCBIBlast
Toolbar
Summary
Bio::Tools::Run::StandAloneNCBIBlast - Object for the local execution
of the NCBI BLAST program suite (blastall, blastpgp, bl2seq). With
experimental support for NCBI rpsblast.
Package variables
No package variables defined.
Inherit
Synopsis
# Do not use directly; see Bio::Tools::Run::StandAloneBlast
Description
See Bio::Tools::Run::StandAloneBlast
Methods
Methods description
Title : new Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new(); Function: Builds a newBio::Tools::Run::StandAloneBlast object Returns : Bio::Tools::Run::StandAloneBlast Args : -quiet => boolean # make program execution quiet -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull' # the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm. Some of the most commonly used parameters are listed below. All parameters have defaults and are optional except for -p in those programs that have it. For a complete listing of settable parameters, run the relevant executable BLAST program with the option "-" as in blastall - Note that the input parameters (-i, -j, -input) should not be set directly by you: this module sets them when you call one of the executable methods. Blastall
-p Program Name [String] Input should be one of "blastp", "blastn", "blastx", "tblastn", or "tblastx". -d Database [String] default = nr The database specified must first be formatted with formatdb. Multiple database names (bracketed by quotations) will be accepted. An example would be -d "nr est" -e Expectation value (E) [Real] default = 10.0 -o BLAST report Output File [File Out] Optional, default = ./blastreport.out ; set by StandAloneBlast.pm -S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer] default = 3
Blastpgp (including Psiblast)
-j is the maximum number of rounds (default 1; i.e., regular BLAST) -h is the e-value threshold for including sequences in the score matrix model (default 0.001) -c is the "constant" used in the pseudocount formula specified in the paper (default 10) -B Multiple alignment file for PSI-BLAST "jump start mode" Optional -Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional
rpsblast
-d Database [String] default = (none - you must specify a database) The database specified must first be formatted with formatdb. Multiple database names (bracketed by quotations) will be accepted. An example would be -d "Cog Smart" -e Expectation value (E) [Real] default = 10.0 -o BLAST report Output File [File Out] Optional, default = ./blastreport.out ; set by StandAloneBlast.pm
Bl2seq
-p Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String] default = blastp -o alignment output file [File Out] default = stdout -e Expectation value (E) [Real] default = 10.0 -S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer] default = 3 |
Title : blastall Usage : $blast_report = $factory->blastall('t/testquery.fa'); or $input = Bio::Seq->new(-id=>"test query", -seq=>"ACTACCCTTTAAATCAGTGGGGG"); $blast_report = $factory->blastall($input); or $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects $blast_report = $factory->blastall($seq_array_ref); Returns : Reference to a Blast object containing the blast report. Args : Name of a file or Bio::Seq object or an array of Bio::Seq object containing the query sequence(s). Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found. |
Title : blastpgp Usage : $blast_report = $factory-> blastpgp('t/testquery.fa'); or $input = Bio::Seq->new(-id=>"test query", -seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); $blast_report = $factory->blastpgp ($input); or $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects $blast_report = $factory-> blastpgp(\@seq_array); Returns : Reference to a Bio::SearchIO object containing the blast report Args : Name of a file or Bio::Seq object. In psiblast jumpstart mode two additional arguments are required: a SimpleAlign object one of whose elements is the query and a "mask" to determine how BLAST should select scoring matrices see DESCRIPTION above for more details.
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
Returns : Reference to Bio::SearchIO object containing the blast report. |
Title : rpsblast Usage : $blast_report = $factory->rpsblast('t/testquery.fa'); or $input = Bio::Seq->new(-id=>"test query", -seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG"); $blast_report = $factory->rpsblast($input); or $seq_array_ref = \@seq_array; # where @seq_array is an array of Bio::Seq objects $blast_report = $factory->rpsblast(\@seq_array); Args : Name of a file or Bio::Seq object or an array of Bio::Seq object containing the query sequence(s). Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found. Returns : Reference to a Bio::SearchIO object containing the blast report |
Title : bl2seq Usage : $factory-> bl2seq('t/seq1.fa', 't/seq2.fa'); or $input1 = Bio::Seq->new(-id=>"test query1", -seq=>"ACTADDEEQQPPTCADEEQQQVVGG"); $input2 = Bio::Seq->new(-id=>"test query2", -seq=>"ACTADDEMMMMMMMDEEQQQVVGG"); $blast_report = $factory->bl2seq ($input1, $input2); Returns : Reference to a BPbl2seq object containing the blast report. Args : Names of 2 files or 2 Bio::Seq objects containing the sequences to be aligned by bl2seq.
Throws an exception if argument is not either a pair of
strings (eg filenames) or references to Bio::Seq objects.
If arguments are strings, throws exception if files
corresponding to string names can not be found. |
Title : _generic_local_blast Usage : internal function not called directly Returns : Bio::SearchIO Args : Reference to calling object and name of BLAST executable |
Title : _runblast Usage : Internal function, not to be called directly Function: makes actual system call to Blast program Example : Returns : Report Bio::SearchIO object in the appropriate format Args : Reference to calling object, name of BLAST executable, and parameter string for executable |
Title : _setparams Usage : Internal function, not to be called directly Function: Create parameter inputs for Blast program Example : Returns : parameter string to be passed to Blast Args : Reference to calling object and name of BLAST executable |
Methods code
sub new
{ my ($caller, @args) = @_;
my $self = $caller->SUPER::new(@args);
my %args = @args;
@args = ();
while (my ($attr, $value) = each %args) {
$attr =~ s/^-//;
$attr = substr($attr, 0, 1) unless $attr =~ /^_/;
push(@args, $attr, $value);
}
$self->_set_from_args(\@args, -methods => {(map { $_ => $GENERAL_PARAMS{$_} } keys %GENERAL_PARAMS),
(map { $_ => $_ } (@OTHER_PARAMS,
@BLASTALL_PARAMS,
@BLASTALL_SWITCH,
@BLASTPGP_PARAMS,
@RPSBLAST_PARAMS,
@BL2SEQ_PARAMS))},
-code => { map { $_ => 'my $self = shift; if (@_) { my $value = shift; if ($value && $value ne\' F\') { $value =\' T\'; } else { $value =\' F\'; } $self->{\'_\'.$method} = $value; } return $self->{\'_\'.$method} || return;' } @BLASTALL_SWITCH }, -create => 1,
-force => 1,
-case_sensitive => 1);
my ($tfh, $tempfile) = $self->io->tempfile();
my $outfile = $self->o || $self->outfile || $tempfile;
$self->o($outfile);
close($tfh);
$self->_READMETHOD($DEFAULTREADMETHOD) unless $self->_READMETHOD;
return $self;
}
} |
sub AUTOLOAD
{ my $self = shift;
my $attr = $AUTOLOAD;
$attr =~ s/.*:://;
my $orig = $attr;
$attr = substr($attr, 0, 1);
$self->can($attr) || $self->throw("Unallowed parameter: $orig !");
return $self->$attr(@_);} |
sub blastall
{ my ($self, $input1) = @_;
$self->io->_io_cleanup();
my $executable = 'blastall';
my $infilename1 = $self->_setinput($executable, $input1) || $self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!");
$self->i($infilename1);
my $blast_report = $self->_generic_local_blast($executable);} |
sub blastpgp
{ my $self = shift;
my $executable = 'blastpgp';
my $input1 = shift;
my $input2 = shift;
my $mask = shift;
my ($infilename1, $infilename2 ) = $self->_setinput($executable,
$input1, $input2,
$mask);
if (!$infilename1) {$self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!");}
$self->i($infilename1); if ($input2) {
unless ($infilename2) {$self->throw("$input2 not SimpleAlign Object in pre-aligned psiblast\n");}
$self->B($infilename2); }
my $blast_report = $self->_generic_local_blast($executable);} |
sub rpsblast
{ my ($self, $input1) = @_;
$self->io->_io_cleanup();
my $executable = 'rpsblast';
my $infilename1 = $self->_setinput($executable, $input1) || $self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!");
$self->i($infilename1);
my $blast_report = $self->_generic_local_blast($executable);} |
sub bl2seq
{ my $self = shift;
my $executable = 'bl2seq';
my $input1 = shift;
my $input2 = shift;
my ($infilename1, $infilename2 ) = $self->_setinput($executable,
$input1, $input2);
if (!$infilename1){$self->throw(" $input1 not Seq Object or file name!");}
if (!$infilename2){$self->throw("$input2 not Seq Object or file name!");}
$self->i($infilename1); $self->j($infilename2);
my $blast_report = $self->_generic_local_blast($executable);} |
sub _generic_local_blast
{ my $self = shift;
my $executable = shift;
my $param_string = $self->_setparams($executable);
my $blast_report = $self->_runblast($executable, $param_string);} |
sub _runblast
{ my ($self, $executable, $param_string) = @_;
my ($blast_obj, $exe);
if (! ($exe = $self->executable($executable)) ) {
$self->warn("cannot find path to $executable");
return;
}
my $commandstring = $exe.$param_string;
$self->debug("$commandstring\n");
system($commandstring) && $self->throw("$executable call crashed: $? | $! | $commandstring\n");
my $signif = $self->e() || 1e-5;
my $outfile = $self->o();
my $method = $self->_READMETHOD;
if ($method =~ /^(?:blast|SearchIO)/i ) {
$method = 'blast' if $method =~ m{SearchIO}i;
$blast_obj = Bio::SearchIO->new(-file => $outfile,
-format => $method);
}
elsif ($method =~ /BPlite/i ) {
if ($executable =~ /bl2seq/i) {
$self->throw("Use of Bio::Tools::BPbl2seq is deprecated; use Bio::SearchIO modules instead");
}
elsif ($executable =~ /blastpgp/i && defined $self->j() && $self->j() > 1) {
$self->throw("Use of Bio::Tools::BPpsilite is deprecated; use Bio::SearchIO modules instead");
}
elsif ($executable =~ /blastall|rpsblast/i) {
$self->throw("Use of Bio::Tools::BPlite is deprecated; use Bio::SearchIO modules instead");
}
else {
$self->warn("Unrecognized executable $executable");
}
}
else {
$self->warn("Unrecognized readmethod $method");
}
return $blast_obj;} |
sub _setparams
{ my ($self, $executable) = @_;
my ($attr, $value, @execparams);
if ($executable eq 'blastall') { @execparams = (@BLASTALL_PARAMS,
@BLASTALL_SWITCH); }
elsif ($executable eq 'blastpgp') { @execparams = @BLASTPGP_PARAMS; }
elsif ($executable eq 'rpsblast') { @execparams = @RPSBLAST_PARAMS; }
elsif ($executable eq 'bl2seq' ) { @execparams = @BL2SEQ_PARAMS; }
push(@execparams, keys %GENERAL_PARAMS);
my $database = $self->d;
if ($database && $executable ne 'bl2seq') {
my @dbs = split(/ /, $database);
for my $i (0..$#dbs) {
if (! (-e $dbs[$i].".nin" || -e $dbs[$i].".pin") &&
! (-e $dbs[$i].".nal" || -e $dbs[$i].".pal") ) {
$dbs[$i] = File::Spec->catdir($DATADIR, $dbs[$i]);
}
}
$self->d('"'.join(" ", @dbs).'"');
}
my $tmp = $self->o;
$self->o(quotemeta($tmp)) if ($tmp && $^O !~ /^MSWin/);
my $param_string = $self->SUPER::_setparams(-params => [@execparams],
-dash => 1);
$self->o($tmp) if ($tmp && $^O !~ /^MSWin/);
$self->d($database) if $database;
if ($self->quiet()) {
$param_string .= ' 2> '.File::Spec->devnull;
}
return $param_string;
}
1;} |
General documentation
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via
the web:
https://redmine.open-bio.org/projects/bioperl/
| AUTHOR - Peter Schattner | Top |
Email schattner at alum.mit.edu
| MAINTAINER - Torsten Seemann | Top |
Email torsten at infotech.monash.edu.au
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _