Bio
PrimarySeq
Summary
Bio::PrimarySeq - Bioperl lightweight Sequence Object
Package variables
No package variables defined.
Included modules
Inherit
Synopsis
# The Bio::SeqIO for file reading, Bio::DB::GenBank for
# database reading
use Bio::Seq;
use Bio::SeqIO;
use Bio::DB::GenBank;
#make from memory
$seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
-id => 'GeneFragment-12',
-accession_number => 'X78121',
-alphabet => 'dna',
-is_circular => 1
);
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, "\n";
# read from file
$inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta');
$seqobj = $inputstream->next_seq();
print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";
# get from database
$db = Bio::DB::GenBank->new();
$seqobj = $db->get_Seq_by_acc('X78121');
# to get out parts of the sequence.
print "Sequence ", $seqobj->id(), " with accession ",
$seqobj->accession_number, " and desc ", $seqobj->desc, "\n";
$string = $seqobj->seq();
$string2 = $seqobj->subseq(1,40);
Description
PrimarySeq is a lightweight Sequence object, storing little more than
the sequence, its name, a computer useful unique name. It does not
contain sequence features or other information. To have a sequence
with sequence features you should use the Seq object which uses this
object.
Sequence objects are defined by the Bio::PrimarySeqI interface, and this
object is a pure Perl implementation of the interface (if that's
gibberish to you, don't worry. The take home message is that this
object is the bioperl default sequence object, but other people can
use their own objects as sequences if they so wish). If you are
interested in wrapping your own objects as compliant Bioperl sequence
objects, then you should read the Bio::PrimarySeqI documentation
The documenation of this object is a merge of the Bio::PrimarySeq and
Bio::PrimarySeqI documentation. This allows all the methods which you can
call on sequence objects here.
Methods
Methods description
Title : new
Usage : $seq = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
-id => 'human_id',
-accession_number => 'AL000012',
);
Function: Returns a new primary seq object from
basic constructors, being a string for the sequence
and strings for id and accession_number.
Note that you can provide an empty sequence string. However, in
this case you MUST specify the type of sequence you wish to
initialize by the parameter -alphabet. See alphabet() for possible
values.
Returns : a new Bio::PrimarySeq object
Args : -seq => sequence string
-display_id => display id of the sequence (locus name)
-accession_number => accession number
-primary_id => primary id (Genbank id)
-desc => description text
-alphabet => molecule type (dna,rna,protein)
-id => alias for display id |
Title : seq
Usage : $string = $obj->seq()
Function: Returns the sequence as a string of letters. The
case of the letters is left up to the implementer.
Suggested cases are upper case for proteins and lower case for
DNA sequence (IUPAC standard), but you should not rely on this
Returns : A scalar |
Title : validate_seq
Usage : if(! $seq->validate_seq($seq_str) ) {
print "sequence $seq_str is not valid for an object of type ",
ref($seq), "\n";
}
Function: Validates a given sequence string. A validating sequence string
must be accepted by seq(). A string that does not validate will
lead to an exception if passed to seq().
The implementation provided here does not take alphabet() into
account. Allowed are all letters (A-Z) and '-','.', '*' and '?'.
Example :
Returns : 1 if the supplied sequence string is valid for the object, and
0 otherwise.
Args : The sequence string to be validated. |
Title : subseq
Usage : $substring = $obj->subseq(10,40);
Function: returns the subseq from start to end, where the first base
is 1 and the number is inclusive, ie 1-2 are the first two
bases of the sequence
Returns : a string
Args : integer for start position
integer for end position
OR
Bio::LocationI location for subseq (strand honored) |
Title : length
Usage : $len = $seq->length()
Function:
Example :
Returns : integer representing the length of the sequence.
Args : |
Title : display_id
Usage : $id_string = $obj->display_id();
Function: returns the display id, aka the common name of the Sequence object.
The semantics of this is that it is the most likely string to
be used as an identifier of the sequence, and likely to have
"human" readability. The id is equivalent to the ID field of
the GenBank/EMBL databanks and the id field of the
Swissprot/sptrembl database. In fasta format, the >(\S+) is
presumed to be the id, though some people overload the id to
embed other information. Bioperl does not use any embedded
information in the ID field, and people are encouraged to use
other mechanisms (accession field for example, or extending
the sequence object) to solve this.
Returns : A string
Args : None |
Title : accession_number
Usage : $unique_key = $obj->accession_number;
Function: Returns the unique biological id for a sequence, commonly
called the accession_number. For sequences from established
databases, the implementors should try to use the correct
accession number. Notice that primary_id() provides the
unique id for the implemetation, allowing multiple objects
to have the same accession number in a particular implementation.
For sequences with no accession number, this method should
return "unknown".
Returns : A string
Args : A string (optional) for setting |
Title : primary_id
Usage : $unique_key = $obj->primary_id;
Function: Returns the unique id for this object in this
implementation. This allows implementations to manage their
own object ids in a way the implementaiton can control
clients can expect one id to map to one object.
For sequences with no natural primary id, this method
should return a stringified memory location.
Returns : A string
Args : A string (optional, for setting) |
Title : alphabet
Usage : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
Function: Returns the type of sequence being one of
'dna', 'rna' or 'protein'. This is case sensitive.
This is not called because this would cause
upgrade problems from the 0.5 and earlier Seq objects.
Returns : a string either 'dna','rna','protein'. NB - the object must
make a call of the type - if there is no type specified it
has to guess.
Args : none |
Title : desc
Usage : $obj->desc($newval)
Function: Get/set description of the sequence.
Example :
Returns : value of desc
Args : newvalue (optional) |
Title : can_call_new
Usage :
Function:
Example :
Returns : true
Args : |
Title : id
Usage : $id = $seq->id()
Function: This is mapped on display_id
Example :
Returns :
Args : |
Title : _guess_alphabet
Usage :
Function:
Example :
Returns :
Args : |
Methods code
BEGIN { %valid_type = map {$_, 1} qw( dna rna protein );} |
sub new
{ my ($class, @args) = @_;
my $self = $class->SUPER::new(@args);
my($seq,$id,$acc,$pid,$desc,$alphabet,$given_id,$is_circular) =
$self->_rearrange([qw(SEQ
DISPLAY_ID
ACCESSION_NUMBER
PRIMARY_ID
DESC
ALPHABET
ID
IS_CIRCULAR
)],
@args);
if( defined $id && defined $given_id ) {
if( $id ne $given_id ) {
$self->throw("Provided both id and display_id constructor ".
"functions. [$id] [$given_id]");
}
}
if( defined $given_id ) { $id = $given_id; }
$alphabet && $self->alphabet($alphabet);
$self->seq($seq) if defined($seq);
$id && $self->display_id($id);
$acc && $self->accession_number($acc);
$pid && $self->primary_id($pid);
$desc && $self->desc($desc);
$is_circular && $self->is_circular($is_circular);
return $self;} |
sub seq
{ my ($obj,$value) = @_;
if( defined $value) {
if(! $obj->validate_seq($value)) {
$obj->throw("Attempting to set the sequence to [$value] ".
"which does not look healthy");
}
my $is_changed_seq = exists($obj->{'seq'});
$obj->{'seq'} = $value;
if(($is_changed_seq && (CORE::length($value) > 0)) ||
(! defined($obj->alphabet()))) {
$obj->_guess_alphabet();
}
}
return $obj->{'seq'};} |
sub validate_seq
{ my ($self,$seqstr) = @_;
if( ! defined $seqstr ){ $seqstr = $self->seq(); }
return 0 unless( defined $seqstr);
if((CORE::length($seqstr) > 0) && ($seqstr !~ /^[A-Za-z\-\.\*\?]+$/)) {
return 0;
}
return 1;} |
sub subseq
{ my ($self,$start,$end) = @_;
if( ref($start) && $start->isa('Bio::LocationI') ) {
my $loc = $start;
if( $loc->length == 0 ) {
$self->warn("Expect location lengths to be > 0");
return '';
} elsif( $loc->end < $loc->start ) {
$self->warn("Expect location start to come before location end");
}
my $seq = '';
if( $loc->isa('Bio::Location::SplitLocationI') ) {
foreach my $subloc ( $loc->sub_Location ) {
my $piece = substr( $self->seq(), $subloc->start - 1,
$subloc->length);
if( $subloc->strand < 0 ) {
$piece = Bio::PrimarySeq->new('-seq' =>
$piece)->revcom()->seq();
}
$seq .= $piece;
}
} else {
$seq = substr( $self->seq(), $loc->start - 1, $loc->length);
}
if( $loc->strand < 0 ) {
$seq = Bio::PrimarySeq->new('-seq' => $seq)->revcom()->seq();
}
return $seq;
}
elsif( defined $start && defined $end ) {
if( $start > $end ){
$self->throw("in subseq, start [$start] has to be ".
"greater than end [$end]");
}
if( $start <= 0 || $end > $self->length ) {
$self->throw("You have to have start positive\n and length less ".
"than the total length of sequence [$start:$end] ".
"Total ".$self->length."");
}
$start--;
return substr $self->seq(), $start, ($end-$start);
} else {
$self->warn("Incorrect parameters to subseq - must be two integers ".
"or a Bio::LocationI object not ($start,$end)");
}} |
sub length
{ my ($self)= @_;
my $seq = $self->seq();
return 0 if ( !defined $seq );
return CORE::length($seq); } |
sub display_id
{ my ($obj,$value) = @_;
if( defined $value) {
$obj->{'display_id'} = $value;
}
return $obj->{'display_id'};} |
sub accession_number
{ my( $obj, $acc ) = @_;
if (defined $acc) {
$obj->{'accession_number'} = $acc;
} else {
$acc = $obj->{'accession_number'};
$acc = 'unknown' unless defined $acc;
}
return $acc;} |
sub primary_id
{ my ($obj,$value) = @_;
if( defined $value) {
$obj->{'primary_id'} = $value;
}
if( ! exists $obj->{'primary_id'} ) {
return "$obj";
}
return $obj->{'primary_id'};} |
sub alphabet
{ my ($obj,$value) = @_;
if (defined $value) {
$value = lc $value;
unless ( $valid_type{$value} ) {
$obj->throw("Molecular type '$value' is not a valid type (".
join(',', map "'$_'", sort keys %valid_type) .
") lowercase");
}
$obj->{'alphabet'} = $value;
}
return $obj->{'alphabet'};} |
sub desc
{ my ($obj,$value) = @_;
if( defined $value) {
$obj->{'desc'} = $value;
}
return $obj->{'desc'};} |
sub can_call_new
{ my ($self) = @_;
return 1; } |
sub id
{ my ($self,$value) = @_;
if( defined $value ) {
return $self->display_id($value);
}
return $self->display_id();} |
sub _guess_alphabet
{ my ($self) = @_;
my ($str,$str2,$total,$atgc,$u,$type);
$str = $self->seq();
$str =~ s/\-\.\?//g;
$total = CORE::length($str);
if( $total == 0 ) {
$self->throw("Got a sequence with no letters in - ".
"cannot guess alphabet [$str]");
}
$str2 = $str;
$str2 =~ s/[ATGCNatgcn]//g;
$atgc = $total - CORE::length $str2;
$str = $str2;
$str2 =~ s/[Uu]//g;
$u = CORE::length($str) - CORE::length($str2);
if( ($atgc / $total) > 0.85 ) { $type = 'dna'; } elsif( (($atgc + $u) / $total) > 0.85 ) {
} |
General documentation
The Sequence object was completely rewritten for the 0.6 series. This
was because the old Sequence object was becoming heavily bloated and
difficult to maintain. There are some key changes from the old object
to the new object, but basically, everything should work with the new
object with a minimal number of changes.
The key change is that the format IO has been removed from this object
and moved to the Bio::SeqIO system, which provides a much better way
to encapsulate the sequence format reading. Please read the SeqIO
documentation, but the take home message is that lines like
# old style reading from files
$seq = Bio::Seq->new( -file => "myfile");
Becomes
# new style reading from files.
$inputstream = Bio::SeqIO->new( -file => "myfile", -format => 'Fasta');
$seqobj = $inputstream->next_seq();
For writing files, a similar system is used
# old style writing to files
print OUTPUT $seq->layout_fasta;
# new style writing to files
$outputstream = Bio::SeqIO->new( -fh => \*OUTPUT, -format => 'Fasta');
$outputstream->write_seq($seqobj);
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bio.perl.org/MailList.html - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
bioperl-bugs@bio.perl.org
http://bio.perl.org/bioperl-bugs/
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
| Methods Inherited from Bio::PrimarySeqI | Top |
These methods are available on Bio::PrimarySeq, although they are
actually implemented on Bio::PrimarySeqI
Title : revcom
Usage : $rev = $seq->revcom()
Function: Produces a new Bio::SeqI implementing object which
is the reversed complement of the sequence. For protein
sequences this throws an exception of
"Sequence is a protein. Cannot revcom"
The id is the same id as the orginal sequence, and the
accession number is also indentical. If someone wants to
track that this sequence has be reversed, it needs to
define its own extensions
To do an inplace edit of an object you can go:
$seqobj = $seqobj->revcom();
This of course, causes Perl to handle the garbage
collection of the old object, but it is roughly speaking as
efficient as an inplace edit.
Returns : A new (fresh) Bio::SeqI object
Args : none
Title : trunc
Usage : $subseq = $myseq->trunc(10,100);
Function: Provides a truncation of a sequence,
Example :
Returns : a fresh Bio::SeqI implementing object
Args :
These are internal methods to PrimarySeq