Bio
Perl
Summary
Bio::Perl - Functional access to BioPerl for people who don't know objects
Package variables
Privates (from "my" definitions)
$refseq_db = undef
$embl_db = undef
$swiss_db = undef
$genpept_db = undef
$genbank_db = undef
Included modules
Inherit
Exporter
Synopsis
use Bio::Perl;
# will guess file format from extension
$seq_object = read_sequence($filename);
# forces genbank format
$seq_object = read_sequence($filename,'genbank');
# reads an array of sequences
@seq_object_array = read_all_sequences($filename,'fasta');
# sequences are Bio::Seq objects, so the following methods work
# for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'
print "Sequence name is ",$seq_object->display_id,"\n";
print "Sequence acc is ",$seq_object->accession_number,"\n";
print "First 5 bases is ",$seq_object->subseq(1,5),"\n";
# get the whole sequence as a single string
$sequence_as_a_string = $seq_object->seq();
# writing sequences
write_sequence(">$filename",'genbank',$seq_object);
write_sequence(">$filename",'genbank',@seq_object_array);
# making a new sequence from just strings you have
# from something else
$seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
"myname","AL12232");
# getting a sequence from a database (assumes internet connection)
$seq_object = get_sequence('swissprot',"ROA1_HUMAN");
$seq_object = get_sequence('embl',"AI129902");
$seq_object = get_sequence('genbank',"AI129902");
# BLAST a sequence (assummes an internet connection)
$blast_report = blast_sequence($seq_object);
write_blast(">blast.out",$blast_report);
Description
Easy first time access to BioPerl via functions
Methods
Methods description
Title : read_sequence
Usage : $seq = read_sequence('sequences.fa')
$seq = read_sequence($filename,'genbank');
# pipes are fine
$seq = read_sequence("my_fetching_program $id |",'fasta');
Function: Reads the top sequence from the file. If no format is given, it will
try to guess the format from the filename. If a format is given, it
forces that format. The filename can be any valid perl open() string
- in particular, you can put in pipes
Returns : A Bio::Seq object. A quick synopsis:
$seq_object->display_id - name of the sequence
$seq_object->seq - sequence as a string
Args : Two strings, first the filename - any Perl open() string is ok
Second string is the format, which is optional
For more information on Seq objects see Bio::Seq. |
Title : read_all_sequences
Usage : @seq_object_array = read_all_sequences($filename);
@seq_object_array = read_all_sequences($filename,'genbank');
Function: Just as the function above, but reads all the sequences in the
file and loads them into an array.
For very large files, you will run out of memory. When this
happens, you've got to use the SeqIO system directly (this is
not so hard! Don't worry about it!).
Returns : array of Bio::Seq objects
Args : two strings, first the filename (any open() string is ok)
second the format (which is optional)
See Bio::SeqIO and Bio::Seq for more information |
Title : write_sequence
Usage : write_sequence(">new_file.gb",'genbank',$seq)
write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
Function: writes sequences in the specified format
Returns : true
Args : filename as a string, must provide an open() output file
format as a string
one or more sequence objects |
Title : new_sequence
Usage :
Function:
Example :
Returns :
Args : |
Title : blast_sequence
Usage : $blast_result = blast_sequence($seq)
$blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');
Function: If the computer has Internet accessibility, blasts
the sequence using the NCBI BLAST server against nrdb.
It choose the flavour of BLAST on the basis of the sequence.
This function uses Bio::Tools::Run::RemoteBlast, which itself
use Bio::SearchIO - as soon as you want to more, check out
these modules
Returns : Bio::Search::Result::GenericResult.pm
Args : Either a string of protein letters or nucleotides, or a
Bio::Seq object |
Title : write_blast
Usage : write_blast($filename,$blast_report);
Function: Writes a BLAST result object (or more formally
a SearchIO result object) out to a filename
in BLAST-like format
Returns : none
Args : filename as a string
Bio::SearchIO::Results object |
Title : get_sequence
Usage : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
Function: If the computer has Internet accessibility, gets
the sequence from Internet accessible databases. Currently
this supports Swissprot, EMBL, GenBank and RefSeq.
Swissprot and EMBL are more robust than GenBank fetching.
If the user is trying to retrieve a RefSeq entry from
GenBank/EMBL, the query is silently redirected.
Returns : A Bio::Seq object
Args : database type - one of swiss, embl, genbank or refseq
identifier or accession number |
Title : translate
Usage : $seqobj = translate($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain
string of DNA to amino acids
Returns : A Bio::Seq object
Args : Either a sequence object or a string of
just DNA sequence characters |
Title : translate_as_string
Usage : $seqstring = translate_as_string($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain
string of DNA to amino acids
Returns : A stirng of just amino acids
Args : Either a sequence object or a string of
just DNA sequence characters |
Title : reverse_complement
Usage : $seqobj = reverse_complement($seq_or_string_scalar)
Function: reverse complements a string or sequnce argument
producing a Bio::Seq - if you want a string, you
can use reverse_complement_as_string
Returns : A Bio::Seq object
Args : Either a sequence object or a string of
just DNA sequence characters |
Title : revcom
Usage : $seqobj = revcom($seq_or_string_scalar)
Function: reverse complements a string or sequnce argument
producing a Bio::Seq - if you want a string, you
can use reverse_complement_as_string
This is an alias for reverse_complement
Returns : A Bio::Seq object
Args : Either a sequence object or a string of
just DNA sequence characters |
Title : reverse_complement_as_string
Usage : $string = reverse_complement_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequnce argument
producing a string
Returns : A string of DNA letters
Args : Either a sequence object or a string of
just DNA sequence characters |
Title : revcom_as_string
Usage : $string = revcom_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequnce argument
producing a string
Returns : A string of DNA letters
Args : Either a sequence object or a string of
just DNA sequence characters |
Methods code
sub read_sequence
{ my ($filename,$format) = @_;
if( !defined $filename ) {
confess "read_sequence($filename) - usage incorrect";
}
my $seqio;
if( defined $format ) {
$seqio = Bio::SeqIO->new( '-file' => $filename, '-format' => $format);
} else {
$seqio = Bio::SeqIO->new( '-file' => $filename);
}
my $seq = $seqio->next_seq();
return $seq;} |
sub read_all_sequences
{ my ($filename,$format) = @_;
if( !defined $filename ) {
confess "read_all_sequences($filename) - usage incorrect";
}
my $seqio;
if( defined $format ) {
$seqio = Bio::SeqIO->new( '-file' => $filename, '-format' => $format);
} else {
$seqio = Bio::SeqIO->new( '-file' => $filename);
}
my @seq_array;
while( my $seq = $seqio->next_seq() ) {
push(@seq_array,$seq);
}
return @seq_array;} |
sub write_sequence
{ my ($filename,$format,@sequence_objects) = @_;
if( scalar(@sequence_objects) == 0 ) {
confess("write_sequence(filename,format,sequence_object)");
}
my $error = 0;
my $seqname = "sequence1";
if( $filename !~ /^\>/ && $filename !~ /^|/ ) {
$filename = ">".$filename;
}
my $seqio = Bio::SeqIO->new('-file' => $filename, '-format' => $format);
foreach my $seq ( @sequence_objects ) {
my $seq_obj;
if( !ref $seq ) {
if( length $seq > 50 ) {
if( $error == 0 ) {
carp("WARNING: You have put in a long string into write_sequence.\nI suspect this means that this is the actual sequence\nIn the future try the\n new_sequence method of this module to make a new sequence object.\nDoing this for you here\n");
$error = 1;
}
$seq_obj = new_sequence($seq,$seqname);
$seqname++;
} else {
confess("You have a non object [$seq] passed to write_sequence. It maybe that you want to use new_sequence to make this string into a sequence object?");
}
} else {
if( !$seq->isa("Bio::SeqI") ) {
confess("object [$seq] is not a Bio::Seq object; can't write it out");
}
$seq_obj = $seq;
}
$seqio->write_seq($seq_obj);
}
1;} |
sub new_sequence
{ my ($seq,$name,$accession) = @_;
if( !defined $seq ) {
confess("new_sequence(sequence_as_string) usage");
}
$name ||= "no-name-for-sequence";
my $seq_object = Bio::Seq->new( -seq => $seq, -id => $name);
$accession && $seq_object->accession_number($accession);
return $seq_object;} |
sub blast_sequence
{ my ($seq,$verbose) = shift;
if( !defined $verbose ) {
$verbose = 1;
}
if( !ref $seq ) {
$seq = Bio::Seq->new( -seq => $seq, -id => 'blast-sequence-temp-id');
} elsif ( !$seq->isa('Bio::PrimarySeqI') ) {
croak("[$seq] is an object, but not a Bio::Seq object, cannot be blasted");
}
require Bio::Tools::Run::RemoteBlast;
my $prog = 'blastp';
my $e_val= '1e-10';
my @params = ( '-prog' => $prog,
'-expect' => $e_val,
'-readmethod' => 'SearchIO' );
my $factory = Bio::Tools::Run::RemoteBlast->new(@params);
my $r = $factory->submit_blast($seq);
if( $verbose ) {
print STDERR "Submitted Blast for [".$seq->id."] ";
}
sleep 5;
my $result;
LOOP :
while( my @rids = $factory->each_rid) {
foreach my $rid ( @rids ) {
my $rc = $factory->retrieve_blast($rid);
if( !ref($rc) ) {
if( $rc < 0 ) {
$factory->remove_rid($rid);
}
if( $verbose ) {
print STDERR ".";
}
sleep 10;
} else {
$result = $rc->next_result();
$factory->remove_rid($rid);
last LOOP;
}
}
}
if( $verbose ) {
print STDERR "\n";
}
return $result;} |
sub write_blast
{ my ($filename,$blast) = @_;
if( $filename !~ /^\>/ && $filename !~ /^|/ ) {
$filename = ">".$filename;
}
my $output = Bio::SearchIO->new( -output_format => 'blast', -file => $filename);
$output->write_result($blast);} |
sub get_sequence
{ my ($db_type,$identifier) = @_;
if( ! $DBOKAY ) {
confess("Your system does not have IO::String installed so the DB retrieval method is not available");
return;
}
$db_type = lc($db_type);
my $db;
if( $db_type =~ /genbank/ ) {
if( !defined $genbank_db ) {
$genbank_db = Bio::DB::GenBank->new();
}
$db = $genbank_db;
}
if( $db_type =~ /genpept/ ) {
if( !defined $genpept_db ) {
$genpept_db = Bio::DB::GenPept->new();
}
$db = $genpept_db;
}
if( $db_type =~ /swiss/ ) {
if( !defined $swiss_db ) {
$swiss_db = Bio::DB::SwissProt->new();
}
$db = $swiss_db;
}
if( $db_type =~ /embl/ ) {
if( !defined $embl_db ) {
$embl_db = Bio::DB::EMBL->new();
}
$db = $embl_db;
}
if( $db_type =~ /refseq/ or ($db_type !~ /swiss/ and
$identifier =~ /^\s*N\S+_/)) {
if( !defined $refseq_db ) {
$refseq_db = Bio::DB::RefSeq->new();
}
$db = $refseq_db;
}
my $seq;
if( $identifier =~ /^\w+\d+$/ ) {
$seq = $db->get_Seq_by_acc($identifier);
} else {
$seq = $db->get_Seq_by_id($identifier);
}
return $seq;} |
sub translate
{ my ($scalar) = shift;
my $obj;
if( ref $scalar ) {
if( !$scalar->isa("Bio::PrimarySeqI") ) {
confess("Expecting a sequence object not a $scalar");
} else {
$obj= $scalar;
}
} else {
my $n = ( $scalar =~ tr/ATGCNatgc/ATGCNatgcn/ );
if( $n < length($scalar) * 0.85 ) {
confess("Sequence [$scalar] is less than 85% ATGCN, which doesn't look very DNA to me");
}
$obj = Bio::PrimarySeq->new(-id => 'internalbioperlseq',-seq => $scalar);
}
return $obj->translate();} |
sub translate_as_string
{ my ($scalar) = shift;
my $obj = Bio::Perl::translate($scalar);
return $obj->seq; } |
sub reverse_complement
{ my ($scalar) = shift;
my $obj;
if( ref $scalar ) {
if( !$scalar->isa("Bio::PrimarySeqI") ) {
confess("Expecting a sequence object not a $scalar");
} else {
$obj= $scalar;
}
} else {
my $n = ( $scalar =~ tr/ATGCNatgc/ATGCNatgcn/ );
if( $n < length($scalar) * 0.85 ) {
confess("Sequence [$scalar] is less than 85% ATGCN, which doesn't look very DNA to me");
}
$obj = Bio::PrimarySeq->new(-id => 'internalbioperlseq',-seq => $scalar);
}
return $obj->revcom();} |
sub revcom
{ return &Bio::Perl::reverse_complement(@_); } |
sub reverse_complement_as_string
{ my ($scalar) = shift;
my $obj = &Bio::Perl::reverse_complement($scalar);
return $obj->seq; } |
sub revcom_as_string
{ my ($scalar) = shift;
my $obj = &Bio::Perl::reverse_complement($scalar);
return $obj->seq; } |
General documentation
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bio.perl.org
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
bioperl-bugs@bio.perl.org
http://bugzilla.bioperl.org/
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _