Bio PrimarySeq
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Summary
Bio::PrimarySeq - Bioperl lightweight Sequence Object
Package variables
Privates (from "my" definitions)
%valid_type = map {$_, 1} qw( dna rna protein )
Included modules
Bio::DescribableI
Bio::IdentifiableI
Bio::PrimarySeqI
Bio::Root::Root
Inherit
Bio::DescribableI Bio::IdentifiableI Bio::PrimarySeqI Bio::Root::Root
Synopsis
  # The Bio::SeqIO for file reading, Bio::DB::GenBank for
  # database reading

  use Bio::Seq;
  use Bio::SeqIO;
  use Bio::DB::GenBank;

  #make from memory
  $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
				   -id  => 'GeneFragment-12',
				   -accession_number => 'X78121',
				   -alphabet => 'dna',
				   -is_circular => 1
				   );
  print "Sequence ", $seqobj->id(), " with accession ", 
    $seqobj->accession_number, "\n";

  # read from file
  $inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta');
  $seqobj = $inputstream->next_seq();
  print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";

  # to get out parts of the sequence.

  print "Sequence ", $seqobj->id(), " with accession ", 
    $seqobj->accession_number, " and desc ", $seqobj->desc, "\n";

  $string  = $seqobj->seq();
  $string2 = $seqobj->subseq(1,40);
Description
PrimarySeq is a lightweight Sequence object, storing little more than
the sequence, its name, a computer useful unique name. It does not
contain sequence features or other information. To have a sequence
with sequence features you should use the Seq object which uses this
object - go perldoc Bio::Seq
Although newusers will use Bio::PrimarySeq alot, in general you will
be using it from the Bio::Seq object. For more information on Bio::Seq
go perldoc Bio::Seq. For interest you might like to known that
Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls
to do with sequence to it (the has-a relationship lets us get out of a
otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this
object is a pure Perl implementation of the interface (if that's
gibberish to you, don't worry. The take home message is that this
object is the bioperl default sequence object, but other people can
use their own objects as sequences if they so wish). If you are
interested in wrapping your own objects as compliant Bioperl sequence
objects, then you should read the Bio::PrimarySeqI documentation
The documenation of this object is a merge of the Bio::PrimarySeq and
Bio::PrimarySeqI documentation. This allows all the methods which you can
call on sequence objects here.
Methods
newDescriptionCode
direct_seq_set
No description
Code
seqDescriptionCode
validate_seqDescriptionCode
subseqDescriptionCode
lengthDescriptionCode
display_idDescriptionCode
accession_numberDescriptionCode
primary_idDescriptionCode
alphabetDescriptionCode
descDescriptionCode
can_call_newDescriptionCode
idDescriptionCode
object_idDescriptionCode
versionDescriptionCode
authorityDescriptionCode
namespaceDescriptionCode
display_nameDescriptionCode
descriptionDescriptionCode
_guess_alphabetDescriptionCode
accession
No description
Code
Methods description
newcode    nextTop
 Title   : new
 Usage   : $seq    = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
                                           -id  => 'human_id',
					   -accession_number => 'AL000012',
					   );

 Function: Returns a new primary seq object from
           basic constructors, being a string for the sequence
           and strings for id and accession_number.

           Note that you can provide an empty sequence string. However, in
           this case you MUST specify the type of sequence you wish to
           initialize by the parameter -alphabet. See alphabet() for possible
           values.
 Returns : a new Bio::PrimarySeq object
 Args    : -seq         => sequence string
           -display_id  => display id of the sequence (locus name) 
           -accession_number => accession number
           -primary_id  => primary id (Genbank id)
           -namespace   => the namespace for the accession
           -authority   => the authority for the namespace
           -desc        => description text
           -alphabet    => sequence type (alphabet) (dna|rna|protein)
           -id          => alias for display id
           -is_circular => boolean field for whether or not sequence is circular
seqcodeprevnextTop
 Title   : seq
 Usage   : $string    = $obj->seq()
 Function: Returns the sequence as a string of letters. The
           case of the letters is left up to the implementer.
           Suggested cases are upper case for proteins and lower case for
           DNA sequence (IUPAC standard), but you should not rely on this
 Returns : A scalar
 Args    : Optionally on set the new value (a string). An optional second
           argument presets the alphabet (otherwise it will be guessed).
           Both parameters may also be given in named paramater style
           with -seq and -alphabet being the names.
validate_seqcodeprevnextTop
 Title   : validate_seq
 Usage   : if(! $seq->validate_seq($seq_str) ) {
                print "sequence $seq_str is not valid for an object of type ",
		      ref($seq), "\n";
	   }
 Function: Validates a given sequence string. A validating sequence string
           must be accepted by seq(). A string that does not validate will
           lead to an exception if passed to seq().

           The implementation provided here does not take alphabet() into
           account. Allowed are all letters (A-Z) and '-','.', '*' and '?'.

 Example :
 Returns : 1 if the supplied sequence string is valid for the object, and
           0 otherwise.
 Args    : The sequence string to be validated.
subseqcodeprevnextTop
 Title   : subseq
 Usage   : $substring = $obj->subseq(10,40);
 Function: returns the subseq from start to end, where the first base
           is 1 and the number is inclusive, ie 1-2 are the first two
           bases of the sequence
 Returns : a string
 Args    : integer for start position
           integer for end position
                 OR
           Bio::LocationI location for subseq (strand honored)
lengthcodeprevnextTop
 Title   : length
 Usage   : $len = $seq->length();
 Function: Get the length of the sequence in number of symbols (bases
           or amino acids).

           You can also set this attribute, even to a number that does
           not match the length of the sequence string. This is useful
           if you don''t want to set the sequence too, or if you want
           to free up memory by unsetting the sequence. In the latter
           case you could do e.g.

               $seq->length($seq->length);
               $seq->seq(undef);

           Note that if you set the sequence to a value other than
           undef at any time, the length attribute will be
           invalidated, and the length of the sequence string will be
           reported again. Also, we won''t let you lie about the length.

 Example :
 Returns : integer representing the length of the sequence.
 Args    : Optionally, the value on set
display_idcodeprevnextTop
 Title   : display_id or display_name
 Usage   : $id_string = $obj->display_id();
 Function: returns the display id, aka the common name of the Sequence object.

           The semantics of this is that it is the most likely string to
           be used as an identifier of the sequence, and likely to have
           "human" readability.  The id is equivalent to the ID field of
           the GenBank/EMBL databanks and the id field of the
           Swissprot/sptrembl database. In fasta format, the >(\S+) is
           presumed to be the id, though some people overload the id to
           embed other information. Bioperl does not use any embedded
           information in the ID field, and people are encouraged to use
           other mechanisms (accession field for example, or extending
           the sequence object) to solve this.

           With the new Bio::DescribeableI interface, display_name aliases
           to this method.

 Returns : A string
 Args    : None
accession_numbercodeprevnextTop
 Title   : accession_number or object_id
 Usage   : $unique_key = $obj->accession_number;
 Function: Returns the unique biological id for a sequence, commonly
           called the accession_number. For sequences from established
           databases, the implementors should try to use the correct
           accession number. Notice that primary_id() provides the
           unique id for the implemetation, allowing multiple objects
           to have the same accession number in a particular implementation.

           For sequences with no accession number, this method should
           return "unknown".

           [Note this method name is likely to change in 1.3]

           With the new Bio::IdentifiableI interface, this is aliased 
           to object_id

 Returns : A string
 Args    : A string (optional) for setting
primary_idcodeprevnextTop
 Title   : primary_id
 Usage   : $unique_key = $obj->primary_id;
 Function: Returns the unique id for this object in this
           implementation. This allows implementations to manage their
           own object ids in a way the implementaiton can control
           clients can expect one id to map to one object.

           For sequences with no natural primary id, this method
           should return a stringified memory location.

 Returns : A string
 Args    : A string (optional, for setting)
alphabetcodeprevnextTop
 Title   : alphabet
 Usage   : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
 Function: Returns the type of sequence being one of
           'dna', 'rna' or 'protein'. This is case sensitive.

           This is not called  because this would cause
           upgrade problems from the 0.5 and earlier Seq objects.

 Returns : a string either 'dna','rna','protein'. NB - the object must
           make a call of the type - if there is no type specified it
           has to guess.
 Args    : none
desccodeprevnextTop
 Title   : desc or description
 Usage   : $obj->desc($newval)
 Function: Get/set description of the sequence.

           description is an alias for this for compliance with the
           Bio::DescribeableI interface.

 Example :
 Returns : value of desc (a string)
 Args    : newvalue (a string or undef, optional)
can_call_newcodeprevnextTop
 Title   : can_call_new
 Usage   :
 Function:
 Example :
 Returns : true
 Args    :
idcodeprevnextTop
 Title   : id
 Usage   : $id = $seq->id()
 Function: This is mapped on display_id
 Example :
 Returns :
 Args    :
object_idcodeprevnextTop
 Title   : object_id
 Usage   : $string    = $obj->object_id()
 Function: a string which represents the stable primary identifier
           in this namespace of this object. For DNA sequences this
           is its accession_number, similarly for protein sequences

           This is aliased to accession_number().
 Returns : A scalar
versioncodeprevnextTop
 Title   : version
 Usage   : $version    = $obj->version()
 Function: a number which differentiates between versions of
           the same object. Higher numbers are considered to be
           later and more relevant, but a single object described
           the same identifier should represent the same concept

 Returns : A number
authoritycodeprevnextTop
 Title   : authority
 Usage   : $authority    = $obj->authority()
 Function: a string which represents the organisation which
           granted the namespace, written as the DNS name for  
           organisation (eg, wormbase.org)

 Returns : A scalar
namespacecodeprevnextTop
 Title   : namespace
 Usage   : $string    = $obj->namespace()
 Function: A string representing the name space this identifier
           is valid in, often the database name or the name
           describing the collection 

 Returns : A scalar
display_namecodeprevnextTop
 Title   : display_name
 Usage   : $string    = $obj->display_name()
 Function: A string which is what should be displayed to the user
           the string should have no spaces (ideally, though a cautious
           user of this interface would not assumme this) and should be
           less than thirty characters (though again, double checking 
           this is a good idea)

           This is aliased to display_id().
 Returns : A scalar
descriptioncodeprevnextTop
 Title   : description
 Usage   : $string    = $obj->description()
 Function: A text string suitable for displaying to the user a 
           description. This string is likely to have spaces, but
           should not have any newlines or formatting - just plain
           text. The string should not be greater than 255 characters
           and clients can feel justified at truncating strings at 255
           characters for the purposes of display

           This is aliased to desc().
 Returns : A scalar
_guess_alphabetcodeprevnextTop
 Title   : _guess_alphabet
 Usage   :
 Function:
 Example :
 Returns :
 Args    :
Methods code
newdescriptionprevnextTop
sub new {
    my ($class, @args) = @_;
    my $self = $class->SUPER::new(@args);

    my($seq,$id,$acc,$pid,$ns,$auth,$v,$oid,
       $desc,$alphabet,$given_id,$is_circular,$direct,$ref_to_seq,$len) =
	$self->_rearrange([qw(SEQ
			      DISPLAY_ID
			      ACCESSION_NUMBER
			      PRIMARY_ID
			      NAMESPACE
			      AUTHORITY
			      VERSION
			      OBJECT_ID
			      DESC
			      ALPHABET
			      ID
			      IS_CIRCULAR
			      DIRECT
			      REF_TO_SEQ
			      LENGTH
			      )],
			  @args);
    if( defined $id && defined $given_id ) {
	if( $id ne $given_id ) {
	    $self->throw("Provided both id and display_id constructor ".
			 "functions. [$id] [$given_id]");	
	}
    }
    if( defined $given_id ) { $id = $given_id; }

    # let's set the length before the seq -- if there is one, this length is
# going to be invalidated
defined $len && $self->length($len); # if alphabet is provided we set it first, so that it won't be guessed
# when the sequence is set
$alphabet && $self->alphabet($alphabet); # if there is an alphabet, and direct is passed in, assumme the alphabet
# and sequence is ok
if( $direct && $ref_to_seq) { $self->{'seq'} = $$ref_to_seq; if( ! $alphabet ) { $self->_guess_alphabet(); } # else it has been set already above
} else { # print STDERR "DEBUG: setting sequence to [$seq]\n";
# note: the sequence string may be empty
$self->seq($seq) if defined($seq); } $id && $self->display_id($id); $acc && $self->accession_number($acc); defined $pid && $self->primary_id($pid); $desc && $self->desc($desc); $is_circular && $self->is_circular($is_circular); $ns && $self->namespace($ns); $auth && $self->authority($auth); defined($v) && $self->version($v); defined($oid) && $self->object_id($oid); return $self;
}
direct_seq_setdescriptionprevnextTop
sub direct_seq_set {
    my $obj = shift;
    return $obj->{'seq'} = shift if @_;
    return undef;
}
seqdescriptionprevnextTop
sub seq {
   my ($obj,@args) = @_;

   if( scalar(@args) == 0 ) {
       return $obj->{'seq'};
   }

   my ($value,$alphabet) = @args;


   if(@args) {
       if(defined($value) && (! $obj->validate_seq($value))) {
	   $obj->throw("Attempting to set the sequence to [$value] ".
		       "which does not look healthy");
       }
       # if a sequence was already set we make sure that we re-adjust the
# mol.type, otherwise we skip guessing if mol.type is already set
# note: if the new seq is empty or undef, we don't consider that a
# change (we wouldn't have anything to guess on anyway)
my $is_changed_seq = exists($obj->{'seq'}) && (CORE::length($value || '') > 0); $obj->{'seq'} = $value; # new alphabet overridden by arguments?
if($alphabet) { # yes, set it no matter what
$obj->alphabet($alphabet); } elsif( # if we changed a previous sequence to a new one
$is_changed_seq || # or if there is no alphabet yet at all
(! defined($obj->alphabet()))) { # we need to guess the (possibly new) alphabet
$obj->_guess_alphabet(); } # else (seq not changed and alphabet was defined) do nothing
# if the seq is changed, make sure we unset a possibly set length
$obj->length(undef) if $is_changed_seq; } return $obj->{'seq'};
}
validate_seqdescriptionprevnextTop
sub validate_seq {
    my ($self,$seqstr) = @_;
    if( ! defined $seqstr ){ $seqstr = $self->seq(); }
    return 0 unless( defined $seqstr); 
    if((CORE::length($seqstr) > 0) && ($seqstr !~ /^([A-Za-z\-\.\*\?]+)$/)) {
	$self->warn("seq doesn't validate, mismatch is " .
		   ($seqstr =~ /([^A-Za-z\-\.\*\?]+)/g));
	return 0;
    }
    return 1;
}
subseqdescriptionprevnextTop
sub subseq {
   my ($self,$start,$end,$replace) = @_;

   if( ref($start) && $start->isa('Bio::LocationI') ) {
       my $loc = $start;
       $replace = $end; # do we really use this anywhere? scary. HL
my $seq = ""; foreach my $subloc ($loc->each_Location()) { my $piece = $self->subseq($subloc->start(), $subloc->end(), $replace); if($subloc->strand() < 0) { $piece = Bio::PrimarySeq->new('-seq' => $piece)->revcom()->seq(); } $seq .= $piece; } return $seq; } elsif( defined $start && defined $end ) { if( $start > $end ){ $self->throw("in subseq, start [$start] has to be ". "greater than end [$end]"); } if( $start <= 0 || $end > $self->length ) { $self->throw("You have to have start positive\n\tand length less ". "than the total length of sequence [$start:$end] ". "Total ".$self->length.""); } # remove one from start, and then length is end-start
$start--; if( defined $replace ) { return substr( $self->seq(), $start, ($end-$start), $replace); } else { return substr( $self->seq(), $start, ($end-$start)); } } else { $self->warn("Incorrect parameters to subseq - must be two integers ". "or a Bio::LocationI object not ($start,$end)"); }
}
lengthdescriptionprevnextTop
sub length {
    my $self = shift;
    my $len = CORE::length($self->seq() || '');
    
    if(@_) {
	my $val = shift;
	if(defined($val) && $len && ($len != $val)) {
	    $self->throw("You're trying to lie about the length: ".
			 "is $len but you say ".$val);
	}
	$self->{'_seq_length'} = $val;
    } elsif(defined($self->{'_seq_length'})) {
	return $self->{'_seq_length'};
    }
    return $len;
}
display_iddescriptionprevnextTop
sub display_id {
   my ($obj,$value) = @_;
   if( defined $value) {
      $obj->{'display_id'} = $value;
    }
    return $obj->{'display_id'};
}
accession_numberdescriptionprevnextTop
sub accession_number {
    my( $obj, $acc ) = @_;

    if (defined $acc) {
        $obj->{'accession_number'} = $acc;
    } else {
        $acc = $obj->{'accession_number'};
        $acc = 'unknown' unless defined $acc;
    }
    return $acc;
}
primary_iddescriptionprevnextTop
sub primary_id {
   my ($obj,$value) = @_;
   if( defined $value) {
      $obj->{'primary_id'} = $value;
    }
   if( ! exists $obj->{'primary_id'} ) {
       return "$obj";
   }
   return $obj->{'primary_id'};
}
alphabetdescriptionprevnextTop
sub alphabet {
    my ($obj,$value) = @_;
    if (defined $value) {
	$value = lc $value;
	unless ( $valid_type{$value} ) {
	    $obj->throw("Molecular type '$value' is not a valid type (".
			join(',', map "'$_'", sort keys %valid_type) .
			") lowercase");
	}
	$obj->{'alphabet'} = $value;
    }
    return $obj->{'alphabet'};
}
descdescriptionprevnextTop
sub desc {
    my $self = shift;

    return $self->{'desc'} = shift if @_;
    return $self->{'desc'};
}
can_call_newdescriptionprevnextTop
sub can_call_new {
   my ($self) = @_;

   return 1;
}
iddescriptionprevnextTop
sub id {
   return shift->display_id(@_);
}
object_iddescriptionprevnextTop
sub object_id {
    return shift->accession_number(@_);
}
versiondescriptionprevnextTop
sub version {
    my ($self,$value) = @_;
    if( defined $value) {
	$self->{'_version'} = $value;
    }
    return $self->{'_version'};
}
authoritydescriptionprevnextTop
sub authority {
    my ($obj,$value) = @_;
    if( defined $value) {
	$obj->{'authority'} = $value;
    }
    return $obj->{'authority'};
}
namespacedescriptionprevnextTop
sub namespace {
    my ($self,$value) = @_;
    if( defined $value) {
	$self->{'namespace'} = $value;
    }
    return $self->{'namespace'} || "";
}
display_namedescriptionprevnextTop
sub display_name {
    return shift->display_id(@_);
}
descriptiondescriptionprevnextTop
sub description {
    return shift->desc(@_);
}
_guess_alphabetdescriptionprevnextTop
sub _guess_alphabet {
   my ($self) = @_;
   my ($str,$str2,$total,$atgc,$u,$type);

   $str = $self->seq();
   $str =~ s/\-\.\?//g;

   $total = CORE::length($str);
   if( $total == 0 ) {
       $self->throw("Got a sequence with no letters in - ".
		    "cannot guess alphabet [$str]");
   }
   
   $u = ($str =~ tr/Uu//);
   $atgc = ($str =~ tr/ATGCNatgcn//);
   
   if( ($atgc / $total) > 0.85 ) {
$type = 'dna';
} elsif( (($atgc + $u) / $total) > 0.85 ) {
}
accessiondescriptionprevnextTop
sub accession {
    my $self = shift;

    $self->warn(ref($self)."::accession is deprecated, ".
		"use accession_number() instead");
    return $self->accession_number(@_);
}
General documentation
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org             - General discussion
  http://bio.perl.org/MailList.html - About the mailing lists
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via email
or the web:
  bioperl-bugs@bio.perl.org
  http://bugzilla.bioperl.org/
AUTHOR - Ewan BirneyTop
Email birney@sanger.ac.uk
Describe contact details here
APPENDIXTop
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
Methods for Bio::IdentifiableI complianceTop
Methods for Bio::DescribableI complianceTop
This comprises of display_name and description.
Methods Inherited from Bio::PrimarySeqITop
These methods are available on Bio::PrimarySeq, although they are
actually implemented on Bio::PrimarySeqI
revcomTop
 Title   : revcom
 Usage   : $rev = $seq->revcom()
 Function: Produces a new Bio::SeqI implementing object which
           is the reversed complement of the sequence. For protein
           sequences this throws an exception of
           "Sequence is a protein. Cannot revcom"

           The id is the same id as the orginal sequence, and the
           accession number is also indentical. If someone wants to
           track that this sequence has be reversed, it needs to
           define its own extensions

           To do an inplace edit of an object you can go:

           $seqobj = $seqobj->revcom();

           This of course, causes Perl to handle the garbage
           collection of the old object, but it is roughly speaking as
           efficient as an inplace edit.

 Returns : A new (fresh) Bio::SeqI object
 Args    : none
truncTop
 Title   : trunc
 Usage   : $subseq = $myseq->trunc(10,100);
 Function: Provides a truncation of a sequence,

 Example :
 Returns : a fresh Bio::SeqI implementing object
 Args    :
Internal methodsTop
These are internal methods to PrimarySeq