Bio::Map
Microsatellite
Summary
Bio::Map::Microsatellite - An object representing a Microsatellite marker.
Package variables
No package variables defined.
Inherit
Synopsis
$o_usat = new Bio::Map::Microsatellite
(-name=>'Chad Super Marker 2',
-sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
-motif => 'at',
-repeats => 15,
-repeat_start_position => 11
);
$sequence_before_usat = $o_usat->get_leading_flank();
$sequence_after_usat = $o_usat->get_trailing_flank();
Description
This object handles the notion of an Microsatellite. This microsatellite can
be placed on a (linear) Map or used on its own. If this Microsatellites
will be used in a mapping context (it doesn't have to, you know) it can have
multiple positions in a map. For information about a Microsatellite's position
in a map one must query the associate PositionI object which is accessible
through the position() method.
Methods
Methods description
Title : new Usage : $o_usat = Function: Builds a new Bio::Map::Microsatellite object Returns : Bio::Map::Microsatellite Args : -name => name of this microsatellite (optional, string, default 'Unknown microsatellite') -positions => position(s) for this marker in maps[optional], An array reference of tuples (array refs themselves) Each tuple conatins a Bio::Map::MapI-inherited object and a Bio::Map::PositionI-inherited obj, no default) -sequence => the sequence of this microsatellite (optional, scalar, no default) -motif => the repeat motif of this microsatellite (optional, scalar, no default) -repeats => the number of motif repeats for this microsatellite (optional, scalar, no default) -repeat_start_position => the starting position of the microsatellite in this sequence. The first base of the sequence is position "1". (optional, scalar, no default)
Note : Creating a Bio::Map::Microsatellite object with no position
might be useful for microsatellite people wanting to embrace
and extend this module. Me! Me! Me!
- using repeat_start_position will trigger a mechinism to
calculate a value for repeat_end_position. |
Title : motif Usage : $o_usat->motif($new_motif); my $motif = $o_usat->motif(); Function: Get/Set the repeat motif for this Microsatellite. Returns : A scalar representing the current repeat motif of this Microsatellite. Args : none to get, OR string to set |
Title : sequence Usage : $o_usat->sequence($new_sequence); my $sequence = $o_usat->sequence(); Function: Get/Set the sequence for this Microsatellite. Returns : A scalar representing the current sequence of this Microsatellite. Args : none to get, OR string to set |
Title : repeats Usage : $o_usat->repeats($new_repeats); my $repeats = $o_usat->repeats() Function: Get/Set the repeat repeats for this Microsatellite. Returns : A scalar representing the current number of repeats of this Microsatellite. Args : none to get, OR int to set |
Title : repeat_start_position Usage : $o_usat->repeat_start_position($new_repeat_start_position); my $repeat_start_position = $o_usat->repeat_start_position(); Function: Get/Set the repeat repeat_start_position for this Microsatellite Returns : A scalar representing the repeat start position for this Microsatellite. Args : none to get, OR string to set This method will also try to set the repeat end position. This depends on having information for the motif and the number of repeats. If you want to use methods like get_trailing_flank or get_leading flank, be careful to include the right information. |
Title : repeat_end_position Usage : $o_usat->repeat_end_position("set"); $o_usat->repeat_end_position($value); $current_repeat_end_position = $o_usat->repeat_end_position(); Function: Get/set the end position of the repeat in this sequence. Returns : A scalar representing the base index of the end of the repeat in this Microsatellite. The first base in the sequence is base 1. Args : A scalar representing a value, the string "set", or no argument (see Notes). Notes : If you do not provide an argument to this method, the current end position of the repeat in this Microsatellite will be returned (a scalar). If you provide the string "set" to this method it will set the end position based on the start position, the length of the motif, and the number of repeats. If you specify a value the current end position of the repeat will be set to that value. This is a really bad idea. Don't do it. |
Title : equals Usage : if ($mappable->equals($mapable2)) {...} Function: Test if a position is equal to another position Returns : boolean Args : Bio::Map::MappableI |
Title : less_than Usage : if ($mappable->less_than($m2)) {...} Function: Tests if a position is less than another position Returns : boolean Args : Bio::Map::MappableI |
Title : greater_than Usage : if ($mappable->greater_than($m2)) {...} Function: Tests if position is greater than another position Returns : boolean Args : Bio::Map::MappableI |
Title : get_leading_flank Usage : $leading_sequence = $o_usat->get_leading_flank(); Returns : A scalar representing the sequence before the repeats in this Microsatellite. Args : none |
Title : get_trailing_flank Usage : $trailing_flank = $o_usat->get_trailing_flank(); Returns : A scalar representing the sequence after the repeats in this Microsatellite. Args : none |
Methods code
sub new
{ my ($class,@args) = @_;
my $self = $class->SUPER::new(@args);
my ($map, $position, $sequence, $motif, $repeats, $start) =
$self->_rearrange([qw(MAP
POSITION
SEQUENCE
MOTIF
REPEATS
REPEAT_START_POSITION
)], @args);
if( ! $self->name ) {
$self->name('Unnamed microsatellite');
}
$map && $self->map($map);
$position && $self->position($position);
$sequence && $self->sequence($sequence);
$self->motif(defined $motif ? $motif : 'Unknown motif');
$repeats && $self->repeats($repeats);
$start && $self->repeat_start_position($start);
return $self;} |
sub motif
{ my ($self,$motif) = @_;
if ($motif) {
$self->{'_motif'} = $motif;
}
return $self->{'_motif'};} |
sub sequence
{ my ($self,$sequence) = @_;
if ($sequence) {
$self->{'_sequence'} = $sequence;
}
return $self->{'_sequence'};} |
sub repeats
{ my ($self,$repeats) = @_;
if ($repeats) {
$self->{'_repeats'} = $repeats;
}
return $self->{'_repeats'};} |
sub repeat_start_position
{ my ($self,$repeat_start_position) = @_;
if ($repeat_start_position) {
$self->{'_repeat_start_position'} = $repeat_start_position;
$self->repeat_end_position("set");
}
return $self->{'_repeat_start_position'};} |
sub repeat_end_position
{ my ($self,$caller) = @_;
if( defined $caller ) {
if ($caller eq "set") {
$self->{'_repeat_end_position'} =
$self->{'_repeat_start_position'} +
(length($self->motif()) * $self->repeats());
}
elsif ($caller) {
$self->{'_repeat_end_position'} = $caller;
}
}
return $self->{'_repeat_end_position'};} |
sub equals
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub less_than
{ my ($self,@args) = @_;
$self->throw_not_implemented();} |
sub greater_than
{ my ($self,@args) = @_;
$self->throw_not_implemented(); } |
sub get_leading_flank
{ my $self = shift;
return substr $self->sequence(),0,$self->repeat_start_position-1; } |
sub get_trailing_flank
{ my $self = shift;
return substr $self->sequence(),$self->repeat_end_position()-1; } |
General documentation
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
| AUTHOR - Chad Matsalla | Top |
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _