Bio::Restriction
Analysis
Summary
Bio::Restriction::Analysis - cutting sequences with restriction
enzymes
Package variables
No package variables defined.
Included modules
Inherit
Synopsis
# analyze a DNA sequence for restriction enzymes
use Bio::Restriction::Analysis;
use Bio::PrimarySeq;
use Data::Dumper;
# get a DNA sequence from somewhere
my $seq = new Bio::PrimarySeq
(-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTC',
-primary_id => 'synopsis',
-molecule => 'dna');
# now start an analysis.
# this is using the default set of enzymes
my $ra = Bio::Restriction::Analysis->new(-seq=>$seq);
# find unique cutters. This returns a
# Bio::Restriction::EnzymeCollection object
my $enzymes = $ra->unique_cutters;
print "Unique cutters: ", join (', ',
map {$_->name} $enzymes->unique_cutters), "\n";
# AluI is one them. Where does it cut?
# This is will return an array of the sequence strings
my $enz = 'AluI';
my @frags = $ra->fragments($enz);
# how big are the fragments?
print "AluI fragment lengths: ", join(' & ', map {length $_} @frags), "\n";
# You can also bypass fragments and call sizes directly:
# to see all the fragment sizes
print "All sizes: ", join " ", $ra->sizes($enz), "\n";
# to see all the fragment sizes sorted by size like on a gel
print "All sizes, sorted ", join (" ", $ra->sizes($enz, 0, 1)), "\n";
# how many times does each enzyme cut
my $cuts = $ra->cuts_by_enzyme('BamHI');
print "BamHI cuts $cuts times\n";
# How many enzymes do not cut at all?
print "There are ", scalar $ra->zero_cutters->each_enzyme,
" enzymes that do not cut\n";
# what about enzymes that cut twice?
my $two_cutters = $ra->cutters(2);
print join (" ", map {$_->name} $two_cutters->each_enzyme),
" cut the sequence twice\n";
# what are all the enzymes that cut, and how often do they cut
printf "\n%-10s%s\n", 'Enzyme', 'Number of Cuts';
my $all_cutters = $ra->cutters;
map {
printf "%-10s%s\n", $_->name, $ra->cuts_by_enzyme($_->name)
} $all_cutters->each_enzyme;
# Finally, we can interact the restriction enzyme object by
# retrieving it from the collection object see the docs for
# Bio::Restriction::Enzyme.pm
my $enzobj = $enzymes->get_enzyme($enz);
Description
Bio::Restriction::Analysis describes the results of cutting a DNA
sequence with restriction enzymes.
To use this module you can pass a sequence object and optionally a
Bio::Restriction::EnzymeCollection that contains the enzyme(s) to cut the
sequences with. There is a default set of enzymes that will be loaded
if you do not pass in a Bio::Restriction::EnzymeCollection.
To cut a sequence, set up a Restriction::Analysis object with a sequence
like this:
use Bio::Restriction::Analysis;
my $ra = Bio::Restriction::Analysis->new(-seq=>$seqobj);
or
my $ra = Bio::Restriction::Analysis->new
(-seq=>$seqobj, -enzymes=>$enzs);
Then, to get the fragments for a particular enzyme use this:
@fragments = $ra->fragments('EcoRI');
Note that the naming of restriction enzymes is that the last numbers
are usually Roman numbers (I, II, III, etc). You may want to use
something like this:
# get a reference to an array of unique (single) cutters
$singles = $re->unique_cutters;
foreach my $enz ($singles->each_enzyme) {
@fragments = $re->fragments($enz);
... do something here ...
}
Note that if your sequence is circular, the first and last fragment
will be joined so that they are the appropriate length and sequence
for further analysis. This fragment will also be checked for cuts
by the enzyme(s). However, this will change the start of the
sequence!
There are two separate algorithms used depending on whether your
enzyme has ambiguity. The non-ambiguous algoritm is a lot faster,
and if you are using very large sequences you should try and use
this algorithm. If you have a large sequence (e.g. genome) and
want to use ambgiuous enzymes you may want to make seperate
Bio::Restriction::Enzyme objects for each of the possible
alternatives and make sure that you do not set is_ambiguous!
This version should correctly deal with overlapping cut sites
in both ambiguous and non-ambiguous enzymes.
I have tried to write this module with speed and memory in mind
so that it can be effectively used for large (e.g. genome sized)
sequence. This module only stores the cut positions internally,
and calculates everything else on an as-needed basis. Therefore
when you call fragment_maps (for example), there may be another
delay while these are generated.
Methods
Methods description
Title : new Function : Initializes the restriction enzyme object Returns : The Restriction::Analysis object Arguments :
$re_anal->new(-seq=$seqobj,
-enzymes=>Restriction::EnzymeCollection object)
-seq requires a Bio::PrimarySeq object
-enzymes is optional.
If ommitted it will use the default set of enzymes
This is the place to start. Pass in a sequence, and you will be able to get the fragments back out. Several other things are available like the number of zero cutters or single cutters. |
Title : seq Usage : $ranalysis->seq($newval); Function : get/set method for the sequence to be cut Example : $re->seq($seq); Returns : value of seq Args : A Bio::PrimarySeqI dna object (optional) |
Title : enzymes Usage : $re->enzymes($newval) Function : gets/Set the restriction enzyme enzymes Example : $re->enzymes('EcoRI') Returns : reference to the collection Args : an array of Bio::Restriction::EnzymeCollection and/or Bio::Restriction::Enzyme objects
The default object for this method is Bio::Restriction::EnzymeCollection. However, you can also pass it a list of Bio::Restriction::Enzyme objects - even mixed with Collection objects. They will all be stored into one collection. |
Title : cut Usage : $re->cut() Function : Cut the sequence with the enzymes Example : $re->cut(); $re->cut('single'); or $re->cut('multiple', $enzymecollection); Returns : $self Args : 'single' (optional), 'multiple' with enzyme collection.
An explicit cut method is needed to pass arguments to it. There are two varieties of cut. Single is the default, and need not be explicitly called. This cuts the sequence with each enzyme separately. Multiple cuts a sequence with more than one enzyme. You must pass it a Bio::Restriction::EnzymeCollection object of the set of enzymes that you want to use in the double digest. The results will be stored as an enzyme named "multiple_digest", so you can use all the retrieval methods to get the data. If you want to use the default setting there is no need to call cut directly. Every method in the class that needs output checks the object's internal status and recalculates the cuts if needed. Note: cut doesn't now re-initialize everything before figuring out cuts. This is so that you can do multiple digests, or add more data or whatever. You'll have to use new to reset everything. See also the comments in above about ambiguous and non-ambiguous sequences. |
Title : positions Function : Retrieve the positions that an enzyme cuts at Returns : An array of the positions that an enzyme cuts at : or an empty array if the enzyme doesn't cut Arguments: An enzyme name to retrieve the positions for Comments : The cut occurs after the base specified. |
Title : fragments Function : Retrieve the fragments that we cut Returns : An array of the fragments retrieved. Arguments: An enzyme name to retrieve the fragments for
For example this code will retrieve the fragments for all enzymes that cut your sequence
my $all_cutters = $analysis->cutters; foreach my $enz ($$all_cutters->each_enzyme}) { @fragments=$analysis->fragments($enz); } |
Title : fragment_maps Function : Retrieves fragment sequences with start and end points. Useful for feature construction.
Returns : An array containing a hash reference for each fragment,
containing the start point, end point and DNA
sequence. The hash keys are 'start', 'end' and
'seq'. Returns an empty array if not defined.
Arguments : An enzyme name, enzyme object,
or enzyme collection to retrieve the fragments for.
If passes an enzyme collection it will return the result of a multiple digest. This : will also cause the special enzyme 'multiple_digest' to be created so you can get : other information about this multiple digest. (TMTOWTDI). There is a minor problem with this and $self->fragments that I haven't got a good answer for (at the moment). If the sequence is not cut, do we return undef, or the whole sequence? For linear fragments it would be good to return the whole sequence. For circular fragments I am not sure. At the moment it returns the whole sequence with start of 1 and end of length of the sequence. For example:
use Bio::Restriction::Analysis; use Bio::Restriction::EnzymeCollection; use Bio::PrimarySeq;
my $seq = new Bio::PrimarySeq
(-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATCCAAAAAAGAGTGAGCTTCTGAT',
-primary_id => 'synopsis',
-molecule => 'dna');
my $ra = Bio::Restriction::Analysis->new(-seq=>$seq);
my @gel;
my @bam_maps = $ra->fragment_maps('BamHI');
foreach my $i (@bam_maps) {
my $start = $i->{start};
my $end = $i->{end};
my $sequence = $i->{seq};
push @gel, "$start--$sequence--$end";
@gel = sort {length $b <=> length $a} @gel;
}
print join("\n", @gel) . "\n"; |
Title : sizes Function : Retrieves an array with the sizes of the fragments Returns : Array that has the sizes of the fragments ordered from largest to smallest like they would appear in a gel. Arguments: An enzyme name to retrieve the sizes for is required and kilobases to the nearest 0.1 kb, else it will be in bp. If the optional third entry is set the results will be sorted.
This is designed to make it easy to see what fragments you should get on a gel! You should be able to do these:
# to see all the fragment sizes, print join "\n", @{$re->sizes($enz)}, "\n"; # to see all the fragment sizes sorted print join "\n", @{$re->sizes($enz, 0, 1)}, "\n"; # to see all the fragment sizes in kb sorted print join "\n", @{$re->sizes($enz, 1, 1)}, "\n"; |
Title : cuts_by_enzyme Function : Return the number of cuts for an enzyme Returns : An integer with the number of times each enzyme cuts. Returns 0 if doesn't cut or undef if not defined Arguments : An enzyme name string |
Title : cutters Function : Find enzymes that cut a given number of times Returns : a Bio::Restriction::EnzymeCollection Arguments : 1. exact time or lower limit, non-negative integer, optional 2. upper limit, non-negative integer, larger or equalthan first, optional
If no argumets are given, the method returns all enzymes that do cut the sequence. The argument zero, '0', is same as method zero_cutters(). The argument one, '1', corresponds to unique_cutters. If either of the limits is larger than number of cuts any enzyme cuts the sequence, the that limit is automagically lowered. The method max_cuts() gives the largest number of cuts. See Also : unique_cutters, zero_cutters, max_cuts |
Title : unique_cutters Function : A special case if cutters() where enzymes only cut once Returns : a Bio::Restriction::EnzymeCollection Arguments : -
See also: cutters, zero_cutters |
Title : zero_cutters Function : A special case if cutters() where enzymes don't cut the sequence Returns : a Bio::Restriction::EnzymeCollection Arguments : -
See also: cutters, unique_cutters |
Title : max_cuts Function : Find the most number of cuts Returns : The number of times the enzyme that cuts most cuts. Arguments : None
This is not a very practical method, but if you are curious... |
Title : _cuts Function : Figures out which enzymes we know about and cuts the sequence. Returns : Nothing. Arguments : None. Comments : An internal method. This will figure out where the sequence should be cut, and provide the appropriate results. |
Title : _enzyme_sites Function : An internal method to figure out the two sides of an enzyme Returns : The sequence before the cut and the sequence after the cut Arguments : A Bio::Restriction::Enzyme object |
Title : _non_pal_enz Function : Analyses non_palindromic enzymes for cuts in both ways Returns : A reference to an array of cut positions Arguments: The sequence to check and the enzyme object |
Title : _ambig_cuts Function : An internal method to localize the cuts in the sequence Returns : A reference to an array of cut positions Arguments : The separated enzyme site, the target sequence, and the enzyme object Comments : This is a slow implementation but works for ambiguous sequences. Whenever possible, _nonambig_cuts should be used as it is a lot faster. |
Title : _nonambig_cuts Function : Figures out which enzymes we know about and cuts the sequence. Returns : Nothing. Arguments : The separated enzyme site, the target sequence, and the enzyme object
An internal method. This will figure out where the sequence should be cut, and provide the appropriate results. This is a much faster implementation because it doesn't use a regexp, but it can not deal with ambiguous sequences |
Title : _circular Function : Deals with circular sequences Returns : Nothing. Arguments : None.
There are two problems with circular sequences.
1. When you cut a sequence and rejoin fragments you could generate new cut sites.
2. There could be a cut site at the end of the sequence.
I think these may be the same problem, and so we're working on #2 first! |
Title : _expanded_string Function : Expand nucleotide ambiguity codes to their representative letters Returns : The full length string Arguments : The string to be expanded.
Stolen from the original RestrictionEnzyme.pm |
Methods code
sub new
{ my($class, @args) = @_;
my $self = $class->SUPER::new(@args);
my ($seq,$enzymes) =
$self->_rearrange([qw(
SEQ
ENZYMES
)], @args);
$seq && $self->seq($seq);
$enzymes ? $self->enzymes($enzymes)
: ($self->{'_enzymes'} = Bio::Restriction::EnzymeCollection->new );
$self->{'_cut'} = 0;
$self->{maximum_cuts} = 0;
$self->{'_number_of_cuts_by_enzyme'} = {};
$self->{'_number_of_cuts_by_cuts'} = {};
$self->{'_fragments'} = {};
$self->{'_cut_positions'} = {}; $self->{'_frag_map_list'} = {};
return $self;} |
sub seq
{ my $self = shift;
if (@_) {
my $seq = shift;
$self->throw('Need a sequence object ['. ref $seq. ']')
unless $seq->isa('Bio::PrimarySeqI');
$self->throw('Need a DNA sequence object ['. $seq->alphabet. ']')
unless $seq->alphabet eq 'dna';
$self->{'_seq'} = $seq;
$self->{'_cut'} = 0;
}
return $self->{'_seq'};} |
sub enzymes
{ my $self = shift;
if (@_) {
$self->{'_enzymes'} = Bio::Restriction::EnzymeCollection->new (-empty => 1)
unless $self->{'_enzymes'};
$self->{'_enzymes'}->enzymes(@_);
$self->{'_cut'} = 0;
}
return $self->{'_enzymes'};} |
sub cut
{ my ($self, $opt, $ec) = @_;
$self->throw("A sequence must be supplied")
unless $self->seq;
if (uc($opt) eq "MULTIPLE") {
$self->throw("You must supply a separate enzyme collection for multiple digests") unless $ec;
$self->_multiple_cuts($ec); } else {
$self->{maximum_cuts} = 0;
$self->{'_number_of_cuts_by_enzyme'} = {};
$self->{'_number_of_cuts_by_cuts'} = {};
$self->{'_fragments'} = {};
$self->{'_cut_positions'} = {}; $self->{'_frag_map_list'} = {};
$self->_cuts;
}
$self->{'_cut'} = 1;
return $self;} |
sub multiple_digest
{ my ($self, $ec)=@_;
return $self->cut('multiple', $ec);} |
sub positions
{ my ($self, $enz) = @_;
$self->cut unless $self->{'_cut'};
$self->throw('no enzyme selected to get positions for')
unless $enz;
return defined $self->{'_cut_positions'}->{$enz} ?
@{$self->{'_cut_positions'}->{$enz}} :
();} |
sub fragments
{ my ($self, $enz) = @_;
$self->cut unless $self->{'_cut'};
$self->throw('no enzyme selected to get fragments for')
unless $enz;
my @fragments;
for ($self->fragment_maps($enz)) {push @fragments, $_->{seq}}
return @fragments;} |
sub fragment_maps
{ my ($self, $enz) = @_;
$self->cut unless $self->{'_cut'};
$self->throw('no enzyme selected to get fragment maps for')
unless $enz;
my @cut_positions;
if (ref $enz eq '') {
@cut_positions=@{$self->{'_cut_positions'}->{$enz}};
} elsif ($enz->isa("Bio::Restriction::EnzymeI")) {
@cut_positions=@{$self->{'_cut_positions'}->{$enz->name}};
} elsif ($enz->isa("Bio::Restriction::EnzymeCollection")) {
$self->cut('multiple', $enz);
@cut_positions=@{$self->{'_cut_positions'}->{'multiple_digest'}};
}
unless ($cut_positions[0]) {
my %map=(
'start' => 1,
'end' => $self->{'_seq'}->length,
'seq' => $self->{'_seq'}->seq
);
push (@{$self->{'_frag_map_list'}->{$enz}},\% map);
return defined $self->{'_frag_map_list'}->{$enz} ?
@{$self->{'_frag_map_list'}->{$enz}} : ();
}
@cut_positions=sort {$a <=> $b} @cut_positions;
push my @cuts, $cut_positions[0];
foreach my $i (@cut_positions) {
push @cuts, $i if $i != $cuts[$#cuts];
}
my $start=1; my $stop; my %seq; my %stop;
foreach $stop (@cuts) {
$seq{$start}=$self->{'_seq'}->subseq($start, $stop);
$stop{$start}=$stop;
$start=$stop+1;
}
$stop=$self->{'_seq'}->length;
if ($start > $stop) {
}
else {
$seq{$start}=$self->{'_seq'}->subseq($start, $stop);
$stop{$start}=$stop;
}
if ($self->{'_seq'}->is_circular) {
$seq{$start}.=$seq{'1'};
delete $seq{'1'};
$stop{$start}=$stop{'1'};
delete $stop{'1'};
}
foreach my $start (sort {$a <=> $b} keys %seq) {
my %map=(
'start' => $start,
'end' => $stop{$start},
'seq' => $seq{$start}
);
push (@{$self->{'_frag_map_list'}->{$enz}},\% map);
}
return defined $self->{'_frag_map_list'}->{$enz} ?
@{$self->{'_frag_map_list'}->{$enz}} : ();} |
sub sizes
{ my ($self, $enz, $kb, $sort) = @_;
$self->throw('no enzyme selected to get fragments for')
unless $enz;
$self->cut unless $self->{'_cut'};
my @frag; my $lastsite=0;
foreach my $site (@{$self->{'_cut_positions'}->{$enz}}) {
$kb ? push (@frag, (int($site-($lastsite))/100)/10)
: push (@frag, $site-($lastsite));
$lastsite=$site;
}
$kb ? push (@frag, (int($self->{'_seq'}->length-($lastsite))/100)/10)
: push (@frag, $self->{'_seq'}->length-($lastsite));
if ($self->{'_seq'}->is_circular) {
my $first=shift @frag;
my $last=pop @frag;
push @frag, ($first+$last);
}
$sort ? @frag = sort {$b <=> $a} @frag : 1;
return @frag;} |
sub cuts_by_enzyme
{ my ($self, $enz)=@_;
$self->throw("Need an enzyme name")
unless defined $enz;
$self->cut unless $self->{'_cut'};
return $self->{'_number_of_cuts_by_enzyme'}->{$enz};} |
sub cutters
{ my ($self, $a, $z) = @_;
$self->cut unless $self->{'_cut'};
my ($start, $end);
if (defined $a) {
$self->throw("Need a non-zero integer [$a]")
unless $a =~ /^[+]?\d+$/;
$start = $a;
} else {
$start = 1;
}
$start = $self->{'maximum_cuts'} if $start > $self->{'maximum_cuts'};
if (defined $z) {
$self->throw("Need a non-zero integer no smaller than start [0]")
unless $z =~ /^[+]?\d+$/ and $z >= $a;
$end = $z;
}
elsif (defined $a) {
$end = $start;
} else {
$end = $self->{'maximum_cuts'};
}
$end = $self->{'maximum_cuts'} if $end > $self->{'maximum_cuts'};
my $set = new Bio::Restriction::EnzymeCollection(-empty => 1);
return $set unless $self->{'maximum_cuts'};
for (my $i=$start; $i<=$end; $i++) {
$set->enzymes( @{$self->{_number_of_cuts_by_cuts}->{$i}} )
if defined $self->{_number_of_cuts_by_cuts}->{$i};
}
return $set;} |
sub unique_cutters
{ shift->cutters(1); } |
sub zero_cutters
{ shift->cutters(0); } |
sub max_cuts
{ return shift->{maximum_cuts}} |
sub _cuts
{ my $self = shift;
my $target_seq=uc $self->{'_seq'}->seq;
foreach my $enz ($self->{'_enzymes'}->each_enzyme) {
my @all_cuts;
my @others = $enz->others if $enz->can("others");
foreach my $enzyme ($enz, @others) {
my ($beforeseq, $afterseq)=$self->_enzyme_sites($enzyme);
my $cut_positions;
if ($enzyme->is_ambiguous) {
$cut_positions= $self->_ambig_cuts($beforeseq, $afterseq, $target_seq, $enzyme);
} else {
$cut_positions= $self->_nonambig_cuts($beforeseq, $afterseq, $target_seq, $enzyme);
}
push @all_cuts, @$cut_positions;
if ($self->{'_seq'}->is_circular) {
$cut_positions=$self->_circular($beforeseq, $afterseq, $enzyme);
push @all_cuts, @$cut_positions;
}
unless ($enzyme->is_palindromic) {
$cut_positions=$self->_non_pal_enz($target_seq, $enzyme);
push @all_cuts, @$cut_positions;
}
}
if (defined $all_cuts[0]) {
@all_cuts = sort {$a <=> $b} @all_cuts;
push @{$self->{'_cut_positions'}->{$enz->name}}, $all_cuts[0];
foreach my $i (@all_cuts) {
push @{$self->{'_cut_positions'}->{$enz->name}}, $i
if $i != ${$self->{'_cut_positions'}->{$enz->name}}[$#{$self->{'_cut_positions'}->{$enz->name}}];
}
} else {
@{$self->{'_cut_positions'}->{$enz->name}}=();
}
my $number_of_cuts=scalar @{$self->{'_cut_positions'}->{$enz->name}};
$self->{_number_of_cuts_by_enzyme}->{$enz->name}=$number_of_cuts;
push (@{$self->{_number_of_cuts_by_cuts}->{$number_of_cuts}}, $enz);
if ($number_of_cuts > $self->{maximum_cuts}) {
$self->{maximum_cuts}=$number_of_cuts;
}
}} |
sub _enzyme_sites
{ my ($self, $enz)=@_;
my $site=$enz->cut;
$site=0 unless defined $site;
my ($beforeseq, $afterseq)= ('.', '.');
if ($site == 0) {
$afterseq=$enz->string;
}
elsif ($site == $enz->seq->length) {
$beforeseq=$enz->string;
}
else {
$beforeseq=$enz->seq->subseq(1, $site);
$afterseq=$enz->seq->subseq($site+1, $enz->seq->length);
}
if ($enz->is_ambiguous) {
$beforeseq=$self->_expanded_string($beforeseq);
$afterseq =$self->_expanded_string($afterseq);
}
return ($beforeseq, $afterseq);} |
sub _non_pal_enz
{ my ($self, $target_seq, $enz) =@_;
my $site=$enz->complementary_cut;
my ($beforeseq, $afterseq)=('.', '.');
my $new_left_cut=$enz->seq->length-$site;
if ($new_left_cut == 0) {$afterseq=$enz->seq->revcom->seq}
elsif ($new_left_cut == $enz->seq->length) {$beforeseq=$enz->seq->revcom->seq}
else {
$beforeseq=$enz->seq->revcom->subseq(1, ($enz->seq->length-$site));
$afterseq=$enz->seq->revcom->subseq(($enz->seq->length-$site), $enz->seq->length);
}
my $results=[];
if ($enz->is_ambiguous) {
$results= $self->_ambig_cuts($beforeseq, $afterseq, $target_seq, $enz);
} else {
$results= $self->_nonambig_cuts($beforeseq, $afterseq, $target_seq, $enz);
}
my $more_results=[];
$more_results=$self->_circular($beforeseq, $afterseq, $enz)
if ($self->{'_seq'}->is_circular);
push my @all_cuts, (@$more_results, @$results);
return\@ all_cuts;} |
sub _ambig_cuts
{ my ($self, $beforeseq, $afterseq, $target_seq, $enz) = @_;
my @cuts = split /($beforeseq)($afterseq)/i, $target_seq;
my $i=0;
my @re_frags;
if ($#cuts) { while ($i<$#cuts) {
my $joinedseq;
if ($i == 0) {
$joinedseq=$cuts[$i].$cuts[$i+1];
} else {
$joinedseq=$cuts[$i-1].$cuts[$i].$cuts[$i+1];
}
while ($joinedseq =~ /$beforeseq$afterseq/) {
$joinedseq =~ s/^(.*?$beforeseq)($afterseq)/$2/;
push @re_frags, $1;
}
push @re_frags, $joinedseq;
$i+=3;
}
} else {
return [];
}
my @cut_positions = map {length($_)} @re_frags;
for (my $i=1; $i<=$#cut_positions; $i++) {
$cut_positions[$i]+=$cut_positions[$i-1];
}
return\@ cut_positions;} |
sub _nonambig_cuts
{ my ($self, $beforeseq, $afterseq, $target_seq, $enz) = @_;
if ($beforeseq eq ".") {$beforeseq = ''}
if ($afterseq eq ".") {$afterseq = ''}
my $index_posn=index($target_seq, $beforeseq.$afterseq);
return [] if ($index_posn == -1);
my @cuts;
while ($index_posn > -1) {
push (@cuts, $index_posn+length($beforeseq));
$index_posn=index($target_seq, $beforeseq.$afterseq, $index_posn+1);
}
return\@ cuts;} |
sub _multiple_cuts
{ my ($self, $ec)=@_;
$self->cut unless $self->{'_cut'};
my @cuts;
foreach my $enz ($ec->each_enzyme) {
push @cuts, @{$self->{'_cut_positions'}->{$enz->name}}
if defined $self->{'_cut_positions'}->{$enz->name};
}
@{$self->{'_cut_positions'}->{'multiple_digest'}}=sort {$a <=> $b} @cuts;
my $number_of_cuts;
$number_of_cuts=scalar @{$self->{'_cut_positions'}->{'multiple_digest'}};
$self->{_number_of_cuts_by_enzyme}->{'multiple_digest'}=$number_of_cuts;
push (@{$self->{_number_of_cuts_by_cuts}->{$number_of_cuts}}, 'multiple_digest');
if ($number_of_cuts > $self->{maximum_cuts}) {
$self->{maximum_cuts}=$number_of_cuts;
}} |
sub _circular
{ my ($self, $beforeseq, $afterseq, $enz) = @_;
my $target_seq=uc $self->{'_seq'}->seq;
my $longest_enz=$self->{'_enzymes'}->longest_cutter;
my $longest_cut=$longest_enz->recognition_length;
$self->throw("Crap. The longest recognition site ($longest_cut) is longer than the".
" length of the sequence") if ($longest_cut > $self->{'_seq'}->length);
my ($first, $last) =
(substr($target_seq, 0, $longest_cut),substr($target_seq, -$longest_cut));
my $newseq=$last.$first;
my $cut_positions;
if ($enz->is_ambiguous) {
$cut_positions= $self->_ambig_cuts($beforeseq, $afterseq, $newseq, $enz);
} else {
$cut_positions=$self->_nonambig_cuts($beforeseq, $afterseq, $newseq, $enz);
}
return [] if (!$cut_positions);
my @circ_cuts;
foreach my $cut (@$cut_positions) {
if ($cut == length($last)) {
push (@circ_cuts, $self->{'_seq'}->length);
}
elsif ($cut < length($last)) {
push (@circ_cuts, $self->{'_seq'}->length - (length($last) - $cut));
}
else {
unshift (@circ_cuts, $cut-length($last));
}
}
return\@ circ_cuts;} |
sub _expanded_string
{ my ($self, $str) = @_;
$str =~ s/N|X/\./g;
$str =~ s/R/\[AG\]/g;
$str =~ s/Y/\[CT\]/g;
$str =~ s/S/\[GC\]/g;
$str =~ s/W/\[AT\]/g;
$str =~ s/M/\[AC\]/g;
$str =~ s/K/\[TG\]/g;
$str =~ s/B/\[CGT\]/g;
$str =~ s/D/\[AGT\]/g;
$str =~ s/H/\[ACT\]/g;
$str =~ s/V/\[ACG\]/g;
return $str;} |
General documentation
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
Heikki Lehvaslaiho, heikki-at-bioperl-dot-org
Copyright (c) 2003 Rob Edwards. Some of this work is Copyright (c)
1997-2002 Steve A. Chervitz. All Rights Reserved.
This module is free software; you can redistribute it and/or modify it
under the same terms as Perl itself.
Methods beginning with a leading underscore are considered private and
are intended for internal use by this module. They are not considered
part of the public interface and are described here for documentation
purposes only.
| Methods to set parameters | Top |
Title : multiple_digest
Function : perform a multiple digest on a sequence
Returns : $self so you can go and get any of the other methods
Arguments : An enzyme collection
Multiple digests can use 1 or more enzymes, and the data is stored
in as if it were an enzyme called multiple_digest. You can then
retrieve information about multiple digests from any of the other
methods.
You can use this method in place of $re->cut('multiple', $enz_coll);
| Query the results of the analysis | Top |
| How many times does enzymes X cut? | Top |
| Which enzymes cut the sequence N times? | Top |
Title : _multiple_cuts
Function : Figures out multiple digests
Returns : An array of the cut sites for multiply digested DNA
Arguments : A Bio::Restriction::EnzymeCollection object
Comments : Double digests is one subset of this, but you can use
as many enzymes as you want.