Bio::Tools::Run StandAloneNCBIBlast
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Summary
Bio::Tools::Run::StandAloneNCBIBlast - Object for the local execution
of the NCBI BLAST program suite (blastall, blastpgp, bl2seq). With
experimental support for NCBI rpsblast.
Package variables
No package variables defined.
Inherit
Bio::Tools::Run::StandAloneBlast
Synopsis
 # Do not use directly; see Bio::Tools::Run::StandAloneBlast
Description
See Bio::Tools::Run::StandAloneBlast
Methods
newDescriptionCode
AUTOLOAD
No description
Code
blastallDescriptionCode
blastpgpDescriptionCode
rpsblastDescriptionCode
bl2seqDescriptionCode
_generic_local_blastDescriptionCode
_runblastDescriptionCode
_setparamsDescriptionCode
Methods description
newcode    nextTop
 Title   : new
Usage : my $obj = Bio::Tools::Run::StandAloneBlast->new();
Function: Builds a newBio::Tools::Run::StandAloneBlast object
Returns : Bio::Tools::Run::StandAloneBlast
Args : -quiet => boolean # make program execution quiet
-_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
# the parsing method, case insensitive
Essentially all BLAST parameters can be set via StandAloneBlast.pm.
Some of the most commonly used parameters are listed below. All
parameters have defaults and are optional except for -p in those programs that
have it. For a complete listing of settable parameters, run the relevant
executable BLAST program with the option "-" as in blastall -
Note that the input paramters (-i, -j, -input) should not be set directly by
you: this module sets them when you call one of the executable methods.
Blastall
  -p  Program Name [String]
Input should be one of "blastp", "blastn", "blastx",
"tblastn", or "tblastx".
-d Database [String] default = nr
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "nr est"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
-S Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
Blastpgp (including Psiblast)
  -j  is the maximum number of rounds (default 1; i.e., regular BLAST)
-h is the e-value threshold for including sequences in the
score matrix model (default 0.001)
-c is the "constant" used in the pseudocount formula specified in the paper (default 10)
-B Multiple alignment file for PSI-BLAST "jump start mode" Optional
-Q Output File for PSI-BLAST Matrix in ASCII [File Out] Optional
rpsblast
  -d  Database [String] default = (none - you must specify a database)
The database specified must first be formatted with formatdb.
Multiple database names (bracketed by quotations) will be accepted.
An example would be -d "Cog Smart"
-e Expectation value (E) [Real] default = 10.0
-o BLAST report Output File [File Out] Optional,
default = ./blastreport.out ; set by StandAloneBlast.pm
Bl2seq
  -p  Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
default = blastp
-o alignment output file [File Out] default = stdout
-e Expectation value (E) [Real] default = 10.0
-S Query strands to search against database (blastn only). 3 is both, 1 is top, 2 is bottom [Integer]
default = 3
blastallcodeprevnextTop
 Title   : blastall
Usage : $blast_report = $factory->blastall('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
or
$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->blastall($seq_array_ref);
Returns : Reference to a Blast object containing the blast report.
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
blastpgpcodeprevnextTop
 Title   : blastpgp
Usage : $blast_report = $factory-> blastpgp('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->blastpgp ($input);
or
$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory-> blastpgp(\@seq_array);
Returns : Reference to a Bio::SearchIO object containing the blast report
Args : Name of a file or Bio::Seq object. In psiblast jumpstart
mode two additional arguments are required: a SimpleAlign
object one of whose elements is the query and a "mask" to
determine how BLAST should select scoring matrices see
DESCRIPTION above for more details.
Throws an exception if argument is not either a string (eg a filename) or a reference to a Bio::Seq object (or to an array of Seq objects). If argument is string, throws exception if file corresponding to string name can not be found. Returns : Reference to Bio::SearchIO object containing the blast report.
rpsblastcodeprevnextTop
 Title   : rpsblast
Usage : $blast_report = $factory->rpsblast('t/testquery.fa');
or
$input = Bio::Seq->new(-id=>"test query",
-seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG");
$blast_report = $factory->rpsblast($input);
or
$seq_array_ref = \@seq_array;
# where @seq_array is an array of Bio::Seq objects
$blast_report = $factory->rpsblast(\@seq_array);
Args : Name of a file or Bio::Seq object or an array of
Bio::Seq object containing the query sequence(s).
Throws an exception if argument is not either a string
(eg a filename) or a reference to a Bio::Seq object
(or to an array of Seq objects). If argument is string,
throws exception if file corresponding to string name can
not be found.
Returns : Reference to a Bio::SearchIO object containing the blast report
bl2seqcodeprevnextTop
 Title   : bl2seq
Usage : $factory-> bl2seq('t/seq1.fa', 't/seq2.fa');
or
$input1 = Bio::Seq->new(-id=>"test query1",
-seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
$input2 = Bio::Seq->new(-id=>"test query2",
-seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
$blast_report = $factory->bl2seq ($input1, $input2);
Returns : Reference to a BPbl2seq object containing the blast report.
Args : Names of 2 files or 2 Bio::Seq objects containing the
sequences to be aligned by bl2seq.
Throws an exception if argument is not either a pair of strings (eg filenames) or references to Bio::Seq objects. If arguments are strings, throws exception if files corresponding to string names can not be found.
_generic_local_blastcodeprevnextTop
 Title   : _generic_local_blast
Usage : internal function not called directly
Returns : Bio::SearchIO
Args : Reference to calling object and name of BLAST executable
_runblastcodeprevnextTop
 Title   :  _runblast
Usage : Internal function, not to be called directly
Function: makes actual system call to Blast program
Example :
Returns : Report Bio::SearchIO object in the appropriate format
Args : Reference to calling object, name of BLAST executable,
and parameter string for executable
_setparamscodeprevnextTop
 Title   : _setparams
Usage : Internal function, not to be called directly
Function: Create parameter inputs for Blast program
Example :
Returns : parameter string to be passed to Blast
Args : Reference to calling object and name of BLAST executable
Methods code
newdescriptionprevnextTop
sub new {
    my ($caller, @args) = @_;
    my $self = $caller->SUPER::new(@args);
    
    # StandAloneBlast is special in that "one can modify the name of
# the (ncbi) BLAST parameters as desired as long as the initial letter (and
# case) of the parameter are preserved". We handle this by truncating input
# args to their first char
my %args = @args; @args = (); while (my ($attr, $value) = each %args) { $attr =~ s/^-//; $attr = substr($attr, 0, 1) unless $attr =~ /^_/; push(@args, $attr, $value); } $self->_set_from_args(\@args, -methods => {(map { $_ => $GENERAL_PARAMS{$_} } keys %GENERAL_PARAMS), (map { $_ => $_ } (@OTHER_PARAMS, @BLASTALL_PARAMS, @BLASTALL_SWITCH, @BLASTPGP_PARAMS, @RPSBLAST_PARAMS, @BL2SEQ_PARAMS))}, -code => { map { $_ => 'my $self = shift;
if (@_) {
my $value = shift;
if ($value && $value ne\' F\') {
$value =\' T\';
}
else {
$value =\' F\';
}
$self->{\'_\'.$method} = $value;
}
return $self->{\'_\'.$method} || return;'
} @BLASTALL_SWITCH }, # these methods can take boolean or 'T' and 'F'
-create => 1, -force => 1, -case_sensitive => 1); my ($tfh, $tempfile) = $self->io->tempfile(); my $outfile = $self->o || $self->outfile || $tempfile; $self->o($outfile); close($tfh); $self->_READMETHOD($DEFAULTREADMETHOD) unless $self->_READMETHOD; return $self; } # StandAloneBlast is special in that "one can modify the name of
# the (ncbi) BLAST parameters as desired as long as the initial letter (and
# case) of the parameter are preserved". We handle this with AUTOLOAD
# redirecting to the automatically created methods from _set_from_args() !
}
AUTOLOADdescriptionprevnextTop
sub AUTOLOAD {
    my $self = shift;
    my $attr = $AUTOLOAD;
    $attr =~ s/.*:://;
    
    my $orig = $attr;
    
    $attr = substr($attr, 0, 1);
    
    $self->can($attr) || $self->throw("Unallowed parameter: $orig !");
    
    return $self->$attr(@_);
}
blastalldescriptionprevnextTop
sub blastall {
    my ($self, $input1) = @_;
    $self->io->_io_cleanup();
    my $executable = 'blastall';
    
    # Create input file pointer
my $infilename1 = $self->_setinput($executable, $input1) || $self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!"); $self->i($infilename1); my $blast_report = $self->_generic_local_blast($executable);
}
blastpgpdescriptionprevnextTop
sub blastpgp {
    my $self = shift;
    my $executable = 'blastpgp';
    my $input1 = shift;
    my $input2 = shift;
    # used by blastpgp's -B option to specify which 
# residues are position aligned
my $mask = shift; my ($infilename1, $infilename2 ) = $self->_setinput($executable, $input1, $input2, $mask); if (!$infilename1) {$self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!");} $self->i($infilename1); # set file name of sequence to be blasted to inputfilename1 (-i param of blastpgp)
if ($input2) { unless ($infilename2) {$self->throw("$input2 not SimpleAlign Object in pre-aligned psiblast\n");} $self->B($infilename2); # set file name of partial alignment to inputfilename2 (-B param of blastpgp)
} my $blast_report = $self->_generic_local_blast($executable);
}
rpsblastdescriptionprevnextTop
sub rpsblast {
    my ($self, $input1) = @_;
    $self->io->_io_cleanup();
    my $executable = 'rpsblast';
    
    # Create input file pointer
my $infilename1 = $self->_setinput($executable, $input1) || $self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!"); $self->i($infilename1); my $blast_report = $self->_generic_local_blast($executable);
}
bl2seqdescriptionprevnextTop
sub bl2seq {
    my $self = shift;
    my $executable = 'bl2seq';
    my $input1 = shift;
    my $input2 = shift;
    
    # Create input file pointer
my ($infilename1, $infilename2 ) = $self->_setinput($executable, $input1, $input2); if (!$infilename1){$self->throw(" $input1 not Seq Object or file name!");} if (!$infilename2){$self->throw("$input2 not Seq Object or file name!");} $self->i($infilename1); # set file name of first sequence to
# be aligned to inputfilename1
# (-i param of bl2seq)
$self->j($infilename2); # set file name of first sequence to
# be aligned to inputfilename2
# (-j param of bl2seq)
my $blast_report = $self->_generic_local_blast($executable);
}
_generic_local_blastdescriptionprevnextTop
sub _generic_local_blast {
    my $self = shift;
    my $executable = shift;
    
    # Create parameter string to pass to Blast program
my $param_string = $self->_setparams($executable); # run Blast
my $blast_report = $self->_runblast($executable, $param_string);
}
_runblastdescriptionprevnextTop
sub _runblast {
	my ($self, $executable, $param_string) = @_;
	my ($blast_obj, $exe);
	if (! ($exe = $self->executable($executable)) ) {
		$self->warn("cannot find path to $executable");
		return;
	}
    
	my $commandstring = $exe.$param_string;
    
	$self->debug("$commandstring\n");
	system($commandstring) && $self->throw("$executable call crashed: $? | $! | $commandstring\n");
    
    # set significance cutoff to set expectation value or default value
# (may want to make this value vary for different executables)
my $signif = $self->e() || 1e-5; # get outputfilename
my $outfile = $self->o(); # this should allow any blast SearchIO parser (not just 'blast_pull' or 'blast',
# but 'blastxml' and 'blasttable'). Fall back to 'blast' if not stipulated.
my $method = $self->_READMETHOD; if ($method =~ /^(?:blast|SearchIO)/i ) { $method = 'blast' if $method =~ m{SearchIO}i; $blast_obj = Bio::SearchIO->new(-file => $outfile, -format => $method); } # should these be here? They have been deprecated...
elsif ($method =~ /BPlite/i ) { if ($executable =~ /bl2seq/i) { # Added program info so BPbl2seq can compute strand info
$self->throw("Use of Bio::Tools::BPbl2seq is deprecated; use Bio::SearchIO modules instead"); } elsif ($executable =~ /blastpgp/i && defined $self->j() && $self->j() > 1) { $self->throw("Use of Bio::Tools::BPpsilite is deprecated; use Bio::SearchIO modules instead"); } elsif ($executable =~ /blastall|rpsblast/i) { $self->throw("Use of Bio::Tools::BPlite is deprecated; use Bio::SearchIO modules instead"); } else { $self->warn("Unrecognized executable $executable"); } } else { $self->warn("Unrecognized readmethod $method"); } return $blast_obj;
}
_setparamsdescriptionprevnextTop
sub _setparams {
    my ($self, $executable) = @_;
    my ($attr, $value, @execparams);
    
    if    ($executable eq 'blastall') { @execparams = (@BLASTALL_PARAMS,
                                                       @BLASTALL_SWITCH); }
    elsif ($executable eq 'blastpgp') { @execparams =  @BLASTPGP_PARAMS;  }
    elsif ($executable eq 'rpsblast') { @execparams =  @RPSBLAST_PARAMS;  }
    elsif ($executable eq 'bl2seq'  ) { @execparams =  @BL2SEQ_PARAMS;    }
    
    # we also have all the general params
push(@execparams, keys %GENERAL_PARAMS); my $database = $self->d; if ($database && $executable ne 'bl2seq') { # Need to prepend datadirectory to database name
my @dbs = split(/ /, $database); for my $i (0..$#dbs) { # (works with multiple databases)
if (! (-e $dbs[$i].".nin" || -e $dbs[$i].".pin") && ! (-e $dbs[$i].".nal" || -e $dbs[$i].".pal") ) { $dbs[$i] = File::Spec->catdir($DATADIR, $dbs[$i]); } } $self->d('"'.join(" ", @dbs).'"'); } # workaround for problems with shell metacharacters [bug 2707]
# simply quoting does not always work!
my $tmp = $self->o; $self->o(quotemeta($tmp)) if ($tmp && $^O !~ /^MSWin/); my $param_string = $self->SUPER::_setparams(-params => [@execparams], -dash => 1); $self->o($tmp) if ($tmp && $^O !~ /^MSWin/); $self->d($database) if $database; if ($self->quiet()) { $param_string .= ' 2> '.File::Spec->devnull; } return $param_string; } 1;
}
General documentation
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via
the web:
  http://bugzilla.open-bio.org/
AUTHOR - Peter SchattnerTop
Email schattner at alum.mit.edu
MAINTAINER - Torsten SeemannTop
Email torsten at infotech.monash.edu.au
CONTRIBUTORSTop
Sendu Bala bix@sendu.me.uk (reimplementation)
APPENDIXTop
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _