Summary

Bio::Tools::Run::StandAloneWUBlast - Object for the local execution
of WU-Blast.

Package variables

Inherit

Bio::Tools::Run::StandAloneBlast

Synopsis

 # Do not use directly; use Bio::Tools::Run::StandAloneBlast

Description

See Bio::Tools::Run::StandAloneBlast

Methods

Methods description

 Title   : new
 Usage   : my $obj = Bio::Tools::Run::StandAloneBlast->new();
 Function: Builds a newBio::Tools::Run::StandAloneBlast object 
 Returns : Bio::Tools::Run::StandAloneBlast
 Args    : -quiet => boolean # make program execution quiet
           -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
                           # the parsing method, case insensitive

  -p Program Name [String] 
        Input should be one of "wublastp", "wublastn", "wublastx", 
        "wutblastn", or "wutblastx".
  -d  Database [String] default = nr
        The database specified must first be formatted with xdformat.
  -E  Expectation value (E) [Real] default = 10.0
  -o  BLAST report Output File [File Out]  Optional,
	    default = ./blastreport.out ; set by StandAloneBlast.pm

 Title   : wublast
 Usage   :  $blast_report = $factory->wublast('t/testquery.fa');
	or
	       $input = Bio::Seq->new(-id=>"test query",
				      -seq=>"ACTACCCTTTAAATCAGTGGGGG");
	       $blast_report = $factory->wublast($input);
	or 
	      $seq_array_ref = \@seq_array;  # where @seq_array is an array of Bio::Seq objects
	      $blast_report = $factory->wublast(\@seq_array);
 Returns :  Reference to a Blast object 
 Args    : Name of a file or Bio::Seq object or an array of 
           Bio::Seq object containing the query sequence(s). 
           Throws an exception if argument is not either a string 
           (eg a filename) or a reference to a Bio::Seq object 
           (or to an array of Seq objects).  If argument is string, 
           throws exception if file corresponding to string name can 
           not be found.

 Title   : _generic_local_wublast
 Usage   :  internal function not called directly
 Returns :  Blast object
 Args    :   Reference to calling object and name of BLAST executable

 Title   :  _runwublast
 Usage   :  Internal function, not to be called directly	
 Function:   makes actual system call to WU-Blast program
 Example :
 Returns : Report Blast object
 Args    : Reference to calling object, name of BLAST executable, 
           and parameter string for executable

 Title   : _setparams
 Usage   : Internal function, not to be called directly	
 Function: Create parameter inputs for Blast program
 Example :
 Returns : parameter string to be passed to Blast 
 Args    : Reference to calling object and name of BLAST executable

Methods code

sub new {

    my ($caller, @args) = @_;
    my $self = $caller->SUPER::new(@args);
    
    $self->_set_from_args(\@args, -methods => {(map { $_ => $GENERAL_PARAMS{$_} } keys %GENERAL_PARAMS),
                                               (map { $_ => $_ } (@OTHER_PARAMS,
                                                                  @WUBLAST_PARAMS,
                                                                  @WUBLAST_SWITCH))},
                                  -create => 1,
                                  -force => 1);
    
    my ($tfh, $tempfile) = $self->io->tempfile();
    my $outfile = $self->o || $self->outfile || $tempfile;
    $self->o($outfile);
    close($tfh);
    
    $self->_READMETHOD($DEFAULTREADMETHOD) unless $self->_READMETHOD;
    
    return $self;
}

# We let get/setter method names be case-insensitve

}

sub AUTOLOAD {

    my $self = shift;
    my $attr = $AUTOLOAD;
    $attr =~ s/.*:://;
    
    my $orig = $attr;
    
    $attr = lc($attr);
    
    $self->can($attr) || $self->throw("Unallowed parameter: $orig !");
    
    return $self->$attr(@_);

}

sub wublast {

    my ($self, $input1) = @_;
    $self->io->_io_cleanup();
    my $executable = 'wublast';
    
    # Create input file pointer
    my $infilename1 = $self->_setinput($executable, $input1) || $self->throw("$input1 not Bio::Seq object or array of Bio::Seq objects or file name!");
    $self->i($infilename1);
    
    my $blast_report = $self->_generic_local_wublast($executable);

}

sub _generic_local_wublast {

    my $self = shift;
    my $executable = shift;
    
    # Create parameter string to pass to Blast program
    my $param_string = $self->_setparams($executable);
    $param_string = " ".$self->database." ".$self->input." ".$param_string;
    
    # run Blast
    my $blast_report = $self->_runwublast($executable, $param_string);

}

sub _runwublast {

	my ($self, $executable, $param_string) = @_;
	my ($blast_obj, $exe);
	if (! ($exe = $self->executable($self->p))){
        $self->warn("cannot find path to $executable");
        return;
	}
    
	my $commandstring = $exe.$param_string;
    
	$self->debug("$commandstring\n");
	system($commandstring) && $self->throw("$executable call crashed: $? | $! | $commandstring\n");
    
    # get outputfilename
	my $outfile = $self->o();	
	$blast_obj = Bio::SearchIO->new(-file => $outfile, -format => 'blast');
    
	return $blast_obj;

}

sub _setparams {

    my ($self, $executable) = @_;
    my ($attr, $value, @execparams);
    
    @execparams = @WUBLAST_PARAMS;
    
    # of the general params, wublast only takes outfile at
    # this stage (we add in program, input and database manually elsewhere)
    push(@execparams, 'o');
    
    # workaround for problems with shell metacharacters [bug 2707]
    # simply quoting does not always work!
    # Fixed so Windows files are not quotemeta'd
    my $tmp = $self->o;
    $self->o(quotemeta($tmp)) if ($tmp && $^O !~ /^MSWin/);
    
    my $param_string = $self->SUPER::_setparams(-params => [@execparams],
                                                -switches =>\@ WUBLAST_SWITCH,
                                                -dash => 1);
    
    $self->o($tmp) if ($tmp && $^O !~ /^MSWin/);
    
    if ($self->quiet()) { 
        $param_string .= ' 2> '.File::Spec->devnull;
    }
    
    return $param_string;
}

1;

}

General documentation

User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via
the web:

  http://bugzilla.open-bio.org/

Email schattner at alum.mit.edu

Email torsten at infotech.monash.edu.au

Sendu Bala bix@sendu.me.uk (reimplementation)

The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _