Bio::Map Microsatellite
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Toolbar
WebCvs
Summary
Bio::Map::Microsatellite - An object representing a Microsatellite marker.
Package variables
No package variables defined.
Inherit
Bio::Map::Marker
Synopsis
  $o_usat = Bio::Map::Microsatellite->new
(-name=>'Chad Super Marker 2',
-sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
-motif => 'at',
-repeats => 15,
-repeat_start_position => 11
);
$sequence_before_usat = $o_usat->get_leading_flank(); $sequence_after_usat = $o_usat->get_trailing_flank();
Description
This object handles the notion of an Microsatellite. This microsatellite can
be placed on a (linear) Map or used on its own. If this Microsatellites
will be used in a mapping context (it doesn't have to, you know) it can have
multiple positions in a map. For information about a Microsatellite's position
in a map one must query the associate PositionI object which is accessible
through the position() method.
Methods
newDescriptionCode
motifDescriptionCode
sequenceDescriptionCode
repeatsDescriptionCode
repeat_start_positionDescriptionCode
repeat_end_positionDescriptionCode
equalsDescriptionCode
less_thanDescriptionCode
greater_thanDescriptionCode
get_leading_flankDescriptionCode
get_trailing_flankDescriptionCode
Methods description
newcode    nextTop
 Title   : new
Usage : $o_usat =
Function: Builds a new Bio::Map::Microsatellite object
Returns : Bio::Map::Microsatellite
Args :
-name => name of this microsatellite (optional, string,
default 'Unknown microsatellite')
-positions => position(s) for this marker in maps[optional],
An array reference of tuples (array refs themselves)
Each tuple conatins a Bio::Map::MapI-inherited object and a
Bio::Map::PositionI-inherited obj, no default)
-sequence => the sequence of this microsatellite (optional,
scalar, no default)
-motif => the repeat motif of this microsatellite (optional,
scalar, no default)
-repeats => the number of motif repeats for this microsatellite
(optional, scalar, no default)
-repeat_start_position => the starting position of the
microsatellite in this sequence. The first base of the
sequence is position "1". (optional, scalar, no default)
Note : Creating a Bio::Map::Microsatellite object with no position might be useful for microsatellite people wanting to embrace and extend this module. Me! Me! Me! - using repeat_start_position will trigger a mechinism to calculate a value for repeat_end_position.
motifcodeprevnextTop
 Title   : motif
Usage : $o_usat->motif($new_motif);
my $motif = $o_usat->motif();
Function: Get/Set the repeat motif for this Microsatellite.
Returns : A scalar representing the current repeat motif of this
Microsatellite.
Args : none to get, OR string to set
sequencecodeprevnextTop
 Title   : sequence
Usage : $o_usat->sequence($new_sequence);
my $sequence = $o_usat->sequence();
Function: Get/Set the sequence for this Microsatellite.
Returns : A scalar representing the current sequence of this
Microsatellite.
Args : none to get, OR string to set
repeatscodeprevnextTop
 Title   : repeats
Usage : $o_usat->repeats($new_repeats);
my $repeats = $o_usat->repeats()
Function: Get/Set the repeat repeats for this Microsatellite.
Returns : A scalar representing the current number of repeats of this
Microsatellite.
Args : none to get, OR int to set
repeat_start_positioncodeprevnextTop
 Title   : repeat_start_position
Usage : $o_usat->repeat_start_position($new_repeat_start_position);
my $repeat_start_position = $o_usat->repeat_start_position();
Function: Get/Set the repeat repeat_start_position for this
Microsatellite
Returns : A scalar representing the repeat start position for this
Microsatellite.
Args : none to get, OR string to set
This method will also try to set the repeat end position. This
depends on having information for the motif and the number of
repeats. If you want to use methods like get_trailing_flank or
get_leading flank, be careful to include the right information.
repeat_end_positioncodeprevnextTop
 Title   : repeat_end_position
Usage : $o_usat->repeat_end_position("set");
$o_usat->repeat_end_position($value);
$current_repeat_end_position = $o_usat->repeat_end_position();
Function: Get/set the end position of the repeat in this sequence.
Returns : A scalar representing the base index of the end of the
repeat in this Microsatellite. The first base in the sequence
is base 1.
Args : A scalar representing a value, the string "set", or no
argument (see Notes).
Notes : If you do not provide an argument to this method, the current
end position of the repeat in this Microsatellite will be
returned (a scalar).
If you provide the string "set" to this method it will set the
end position based on the start position, the length of the
motif, and the number of repeats.
If you specify a value the current end position of the repeat
will be set to that value. This is a really bad idea. Don't do
it.
equalscodeprevnextTop
 Title   : equals
Usage : if ($mappable->equals($mapable2)) {...}
Function: Test if a position is equal to another position
Returns : boolean
Args : Bio::Map::MappableI
less_thancodeprevnextTop
 Title   : less_than
Usage : if ($mappable->less_than($m2)) {...}
Function: Tests if a position is less than another position
Returns : boolean
Args : Bio::Map::MappableI
greater_thancodeprevnextTop
 Title   : greater_than
Usage : if ($mappable->greater_than($m2)) {...}
Function: Tests if position is greater than another position
Returns : boolean
Args : Bio::Map::MappableI
get_leading_flankcodeprevnextTop
 Title   : get_leading_flank
Usage : $leading_sequence = $o_usat->get_leading_flank();
Returns : A scalar representing the sequence before the repeats in this
Microsatellite.
Args : none
get_trailing_flankcodeprevnextTop
 Title   : get_trailing_flank
Usage : $trailing_flank = $o_usat->get_trailing_flank();
Returns : A scalar representing the sequence after the repeats in this
Microsatellite.
Args : none
Methods code
newdescriptionprevnextTop
sub new {
    my ($class,@args) = @_;
    my $self = $class->SUPER::new(@args);
    my ($map, $position, $sequence, $motif, $repeats, $start) = 
	$self->_rearrange([qw(MAP
			      POSITION
			      SEQUENCE 
			      MOTIF 
			      REPEATS 
			      REPEAT_START_POSITION
			      )], @args);
    if( ! $self->name ) { 
	$self->name('Unnamed microsatellite');
    }
    $map && $self->map($map);
    $position && $self->position($position);
    $sequence && $self->sequence($sequence);
    $self->motif(defined $motif ? $motif : 'Unknown motif'); 
    $repeats && $self->repeats($repeats);
    $start && $self->repeat_start_position($start);
    return $self;
}
motifdescriptionprevnextTop
sub motif {
	my ($self,$motif) = @_;
	if ($motif) {
		$self->{'_motif'} = $motif;
	}
	return $self->{'_motif'};
}
sequencedescriptionprevnextTop
sub sequence {
	my ($self,$sequence) = @_;
	if ($sequence) {
		$self->{'_sequence'} = $sequence;
	}
	return $self->{'_sequence'};
}
repeatsdescriptionprevnextTop
sub repeats {
	my ($self,$repeats) = @_;
	if ($repeats) {
		$self->{'_repeats'} = $repeats;
	}
	return $self->{'_repeats'};
}
repeat_start_positiondescriptionprevnextTop
sub repeat_start_position {
	my ($self,$repeat_start_position) = @_;
	if ($repeat_start_position) {
		$self->{'_repeat_start_position'} = $repeat_start_position;
		$self->repeat_end_position("set");
	}
	return $self->{'_repeat_start_position'};
}
repeat_end_positiondescriptionprevnextTop
sub repeat_end_position {
    my ($self,$caller) = @_;
    if( defined $caller ) { 
	if ($caller eq "set") {
	    $self->{'_repeat_end_position'} = 
		$self->{'_repeat_start_position'} + 
		    (length($self->motif()) * $self->repeats());
	}
	elsif ($caller) {
	    $self->{'_repeat_end_position'} = $caller;
	}
    }
    return $self->{'_repeat_end_position'};
}
equalsdescriptionprevnextTop
sub equals {
	my ($self,@args) = @_;
	$self->throw_not_implemented();
}
less_thandescriptionprevnextTop
sub less_than {
	my ($self,@args) = @_;
        $self->throw_not_implemented();
}
greater_thandescriptionprevnextTop
sub greater_than {
	my ($self,@args) = @_;
	$self->throw_not_implemented();
}
get_leading_flankdescriptionprevnextTop
sub get_leading_flank {
	my $self = shift;
	return substr $self->sequence(),0,$self->repeat_start_position-1;
}
get_trailing_flankdescriptionprevnextTop
sub get_trailing_flank {
	my $self = shift;
	return substr $self->sequence(),$self->repeat_end_position()-1;
}

1;
}
General documentation
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support Top
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via the
web:
  https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Chad MatsallaTop
Email bioinformatics1@dieselwurks.com
CONTRIBUTORSTop
Heikki Lehvaslaiho heikki-at-bioperl-dot-org
Lincoln Stein lstein@cshl.org
Jason Stajich jason@bioperl.org
Sendu Bala bix@sendu.me.uk
APPENDIXTop
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _