Bio Perl
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Toolbar
WebCvs
Summary
Bio::Perl - Functional access to BioPerl for people who don't know objects
Package variables
Privates (from "my" definitions)
$refseq_db = undef
$embl_db = undef
$swiss_db = undef
$genpept_db = undef
$genbank_db = undef
Included modules
Bio::Root::Version ' $VERSION '
Bio::Seq
Bio::SeqIO
Carp
Inherit
Exporter
Synopsis
  use Bio::Perl;
# will guess file format from extension $seq_object = read_sequence($filename); # forces genbank format $seq_object = read_sequence($filename,'genbank'); # reads an array of sequences @seq_object_array = read_all_sequences($filename,'fasta'); # sequences are Bio::Seq objects, so the following methods work # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm' print "Sequence name is ",$seq_object->display_id,"\n"; print "Sequence acc is ",$seq_object->accession_number,"\n"; print "First 5 bases is ",$seq_object->subseq(1,5),"\n"; # get the whole sequence as a single string $sequence_as_a_string = $seq_object->seq(); # writing sequences write_sequence(">$filename",'genbank',$seq_object); write_sequence(">$filename",'genbank',@seq_object_array); # making a new sequence from just a string $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA", "myname","AL12232"); # getting a sequence from a database (assumes internet connection) $seq_object = get_sequence('swissprot',"ROA1_HUMAN"); $seq_object = get_sequence('embl',"AI129902"); $seq_object = get_sequence('genbank',"AI129902"); # BLAST a sequence (assummes an internet connection) $blast_report = blast_sequence($seq_object); write_blast(">blast.out",$blast_report);
Description
Easy first time access to BioPerl via functions.
Methods
BEGIN Code
read_sequenceDescriptionCode
read_all_sequencesDescriptionCode
write_sequenceDescriptionCode
new_sequenceDescriptionCode
blast_sequenceDescriptionCode
write_blastDescriptionCode
get_sequenceDescriptionCode
translateDescriptionCode
translate_as_stringDescriptionCode
reverse_complementDescriptionCode
revcomDescriptionCode
reverse_complement_as_stringDescriptionCode
revcom_as_stringDescriptionCode
Methods description
read_sequencecode    nextTop
 Title   : read_sequence
Usage : $seq = read_sequence('sequences.fa')
$seq = read_sequence($filename,'genbank');
# pipes are fine $seq = read_sequence("my_fetching_program $id |",'fasta'); Function: Reads the top sequence from the file. If no format is given, it will try to guess the format from the filename. If a format is given, it forces that format. The filename can be any valid perl open() string - in particular, you can put in pipes Returns : A Bio::Seq object. A quick synopsis: $seq_object->display_id - name of the sequence $seq_object->seq - sequence as a string Args : Two strings, first the filename - any Perl open() string is ok Second string is the format, which is optional
For more information on Seq objects see Bio::Seq.
read_all_sequencescodeprevnextTop
 Title   : read_all_sequences
Usage : @seq_object_array = read_all_sequences($filename);
@seq_object_array = read_all_sequences($filename,'genbank');
Function: Just as the function above, but reads all the sequences in the file and loads them into an array. For very large files, you will run out of memory. When this happens, you've got to use the SeqIO system directly (this is not so hard! Don't worry about it!). Returns : array of Bio::Seq objects Args : two strings, first the filename (any open() string is ok) second the format (which is optional)
See Bio::SeqIO and Bio::Seq for more information
write_sequencecodeprevnextTop
 Title   : write_sequence
Usage : write_sequence(">new_file.gb",'genbank',$seq)
write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
Function: writes sequences in the specified format Returns : true Args : filename as a string, must provide an open() output file format as a string one or more sequence objects
new_sequencecodeprevnextTop
 Title   : new_sequence
Usage : $seq_obj = new_sequence("GATTACA", "kino-enzyme");
Function: Construct a sequency object from sequence string Returns : A Bio::Seq object Args : sequence string name string (optional, default "no-name-for-sequence") accession - accession number (optional, no default)
blast_sequencecodeprevnextTop
 Title   : blast_sequence
Usage : $blast_result = blast_sequence($seq)
$blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');
Function: If the computer has Internet accessibility, blasts the sequence using the NCBI BLAST server against nrdb. It chooses the flavour of BLAST on the basis of the sequence. This function uses Bio::Tools::Run::RemoteBlast, which itself use Bio::SearchIO - as soon as you want to know more, check out these modules Returns : Bio::Search::Result::GenericResult.pm Args : Either a string of protein letters or nucleotides, or a Bio::Seq object
write_blastcodeprevnextTop
 Title   : write_blast
Usage : write_blast($filename,$blast_report);
Function: Writes a BLAST result object (or more formally a SearchIO result object) out to a filename in BLAST-like format Returns : none Args : filename as a string Bio::SearchIO::Results object
get_sequencecodeprevnextTop
 Title   : get_sequence
Usage : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
Function: If the computer has Internet access this method gets the sequence from Internet accessible databases. Currently this supports Swissprot ('swiss'), EMBL ('embl'), GenBank ('genbank'), GenPept ('genpept'), and RefSeq ('refseq'). Swissprot and EMBL are more robust than GenBank fetching. If the user is trying to retrieve a RefSeq entry from GenBank/EMBL, the query is silently redirected. Returns : A Bio::Seq object Args : database type - one of swiss, embl, genbank, genpept, or refseq
translatecodeprevnextTop
 Title   : translate
Usage : $seqobj = translate($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain string of DNA to amino acids Returns : A Bio::Seq object Args : Either a sequence object or a string of just DNA sequence characters
translate_as_stringcodeprevnextTop
 Title   : translate_as_string
Usage : $seqstring = translate_as_string($seq_or_string_scalar)
Function: translates a DNA sequence object OR just a plain string of DNA to amino acids Returns : A string of just amino acids Args : Either a sequence object or a string of just DNA sequence characters
reverse_complementcodeprevnextTop
 Title   : reverse_complement
Usage : $seqobj = reverse_complement($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a Bio::Seq - if you want a string, you can use reverse_complement_as_string Returns : A Bio::Seq object Args : Either a sequence object or a string of just DNA sequence characters
revcomcodeprevnextTop
 Title   : revcom
Usage : $seqobj = revcom($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a Bio::Seq - if you want a string, you can use reverse_complement_as_string This is an alias for reverse_complement Returns : A Bio::Seq object Args : Either a sequence object or a string of just DNA sequence characters
reverse_complement_as_stringcodeprevnextTop
 Title   : reverse_complement_as_string
Usage : $string = reverse_complement_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a string Returns : A string of DNA letters Args : Either a sequence object or a string of just DNA sequence characters
revcom_as_stringcodeprevnextTop
 Title   : revcom_as_string
Usage : $string = revcom_as_string($seq_or_string_scalar)
Function: reverse complements a string or sequence argument producing a string Returns : A string of DNA letters Args : Either a sequence object or a string of just DNA sequence characters
Methods code
BEGINTop
BEGIN {
    eval {
	require Bio::DB::EMBL;
	require Bio::DB::GenBank;
	require Bio::DB::SwissProt;
	require Bio::DB::RefSeq;
	require Bio::DB::GenPept;
    };
    if( $@ ) {
	$DBOKAY = 0;
    } else {
	$DBOKAY = 1;
}
read_sequencedescriptionprevnextTop
sub read_sequence {
   my ($filename,$format) = @_;

   if( !defined $filename ) {
       confess "read_sequence($filename) - usage incorrect";
   }

   my $seqio;

   if( defined $format ) {
       $seqio = Bio::SeqIO->new( '-file' => $filename, '-format' => $format);
   } else {
       $seqio = Bio::SeqIO->new( '-file' => $filename);
   }

   my $seq = $seqio->next_seq();

   return $seq;
}
read_all_sequencesdescriptionprevnextTop
sub read_all_sequences {
   my ($filename,$format) = @_;

   if( !defined $filename ) {
       confess "read_all_sequences($filename) - usage incorrect";
   }

   my $seqio;

   if( defined $format ) {
       $seqio = Bio::SeqIO->new( '-file' => $filename, '-format' => $format);
   } else {
       $seqio = Bio::SeqIO->new( '-file' => $filename);
   }

   my @seq_array;

   while( my $seq = $seqio->next_seq() ) {
       push(@seq_array,$seq);
   }

   return @seq_array;
}
write_sequencedescriptionprevnextTop
sub write_sequence {
   my ($filename,$format,@sequence_objects) = @_;

   if( scalar(@sequence_objects) == 0 ) {
       confess("write_sequence(filename,format,sequence_object)");
   }

   my $error = 0;
   my $seqname = "sequence1";

   # catch users who haven't passed us a filename we can open
if( $filename !~ /^\>/ && $filename !~ /^|/ ) { $filename = ">".$filename; } my $seqio = Bio::SeqIO->new('-file' => $filename, '-format' => $format); foreach my $seq ( @sequence_objects ) { my $seq_obj; if( !ref $seq ) { if( length $seq > 50 ) { # odds are this is a sequence as a string, and someone has not figured out
# how to make objects. Warn him/her and then make a sequence object
# from this
if( $error == 0 ) { carp("WARNING: You have put in a long string into write_sequence.\nI suspect this means that this is the actual sequence\nIn the future try the\n new_sequence method of this module to make a new sequence object.\nDoing this for you here\n"); $error = 1; } $seq_obj = new_sequence($seq,$seqname); $seqname++; } else { confess("You have a non object [$seq] passed to write_sequence. It maybe that you want to use new_sequence to make this string into a sequence object?"); } } else { if( !$seq->isa("Bio::SeqI") ) { confess("object [$seq] is not a Bio::Seq object; can't write it out"); } $seq_obj = $seq; } # finally... we get to write out the sequence!
$seqio->write_seq($seq_obj); } 1;
}
new_sequencedescriptionprevnextTop
sub new_sequence {
   my ($seq,$name,$accession) = @_;

   if( !defined $seq ) {
       confess("new_sequence(sequence_as_string) usage");
   }

   $name ||= "no-name-for-sequence";

   my $seq_object = Bio::Seq->new( -seq => $seq, -id => $name);

   $accession && $seq_object->accession_number($accession);

   return $seq_object;
}
blast_sequencedescriptionprevnextTop
sub blast_sequence {
    my ($seq,$verbose) = @_;

    if( !defined $verbose ) {
	$verbose = 1;
    }

    if( !ref $seq ) {
	$seq = Bio::Seq->new( -seq => $seq, -id => 'blast-sequence-temp-id');
    } elsif ( !$seq->isa('Bio::PrimarySeqI') ) {
	croak("[$seq] is an object, but not a Bio::Seq object, cannot be blasted");
    }

    require Bio::Tools::Run::RemoteBlast;

    my $prog = ( $seq->alphabet eq 'protein' ) ? 'blastp' : 'blastn';
    my $e_val= '1e-10';

    my @params = ( '-prog' => $prog,
		   '-expect' => $e_val,
		   '-readmethod' => 'SearchIO' );

    my $factory = Bio::Tools::Run::RemoteBlast->new(@params);

    my $r = $factory->submit_blast($seq);
    if( $verbose ) {
	print STDERR "Submitted Blast for [".$seq->id."] ";
    }
    sleep 5;

    my $result;

    LOOP :
    while( my @rids = $factory->each_rid) {
	foreach my $rid ( @rids ) {
	    my $rc = $factory->retrieve_blast($rid);
	    if( !ref($rc) ) {
		if( $rc < 0 ) {
		    $factory->remove_rid($rid);
		}
		if( $verbose ) {
		    print STDERR ".";
		}
		sleep 10;
	    } else {
		$result = $rc->next_result();
		$factory->remove_rid($rid);
		last LOOP;
	    }
	}
    }

    if( $verbose ) {
	print STDERR "\n";
    }
    return $result;
}
write_blastdescriptionprevnextTop
sub write_blast {
    my ($filename,$blast) = @_;

    if( $filename !~ /^\>/ && $filename !~ /^|/ ) {
	$filename = ">".$filename;
    }

    my $output = Bio::SearchIO->new( -output_format => 'blast', -file => $filename);

    $output->write_result($blast);
}
get_sequencedescriptionprevnextTop
sub get_sequence {
   my ($db_type,$identifier) = @_;
   if( ! $DBOKAY ) {
       confess ("Your system does not have one of LWP, HTTP::Request::Common, IO::String installed so the DB retrieval method is not available.\n  Full error message is:\n $!\n");
       return;
   }
   $db_type = lc($db_type);

   my $db;

   if( $db_type =~ /genbank/ ) {
       if( !defined $genbank_db ) {
	   $genbank_db = Bio::DB::GenBank->new();
       }
       $db = $genbank_db;
   }
   if( $db_type =~ /genpept/ ) {
       if( !defined $genpept_db ) {
	   $genpept_db = Bio::DB::GenPept->new();
       }
       $db = $genpept_db;
   }

   if( $db_type =~ /swiss/ ) {
       if( !defined $swiss_db ) {
	   $swiss_db = Bio::DB::SwissProt->new();
       }
       $db = $swiss_db;
   }

   if( $db_type =~ /embl/ ) {
       if( !defined $embl_db ) {
	   $embl_db = Bio::DB::EMBL->new();
       }
       $db = $embl_db;
   }

   if( $db_type =~ /refseq/ or ($db_type !~ /swiss/ and
				$identifier =~ /^\s*N\S+_/)) {
       if( !defined $refseq_db ) {
	   $refseq_db = Bio::DB::RefSeq->new();
       }
       $db = $refseq_db;
   }

   my $seq;

   if( $identifier =~ /^\w+\d+$/ ) {
       $seq = $db->get_Seq_by_acc($identifier);
   } else {
       $seq = $db->get_Seq_by_id($identifier);
   }

   return $seq;
}
translatedescriptionprevnextTop
sub translate {
   my ($scalar) = shift;

   my $obj;

   if( ref $scalar ) {
     if( !$scalar->isa("Bio::PrimarySeqI") ) {
        confess("Expecting a sequence object not a $scalar");
     } else {
        $obj= $scalar;

     }

   } else {

     # check this looks vaguely like DNA
my $n = ( $scalar =~ tr/ATGCNatgcn/ATGCNatgcn/ ); if( $n < length($scalar) * 0.85 ) { confess("Sequence [$scalar] is less than 85% ATGCN, which doesn't look very DNA to me"); } $obj = Bio::PrimarySeq->new(-id => 'internalbioperlseq',-seq => $scalar); } return $obj->translate();
}
translate_as_stringdescriptionprevnextTop
sub translate_as_string {
   my ($scalar) = shift;

   my $obj = Bio::Perl::translate($scalar);

   return $obj->seq;
}
reverse_complementdescriptionprevnextTop
sub reverse_complement {
   my ($scalar) = shift;

   my $obj;

   if( ref $scalar ) {
     if( !$scalar->isa("Bio::PrimarySeqI") ) {
        confess("Expecting a sequence object not a $scalar");
     } else {
        $obj= $scalar;

     }

   } else {

     # check this looks vaguely like DNA
my $n = ( $scalar =~ tr/ATGCNatgcn/ATGCNatgcn/ ); if( $n < length($scalar) * 0.85 ) { confess("Sequence [$scalar] is less than 85% ATGCN, which doesn't look very DNA to me"); } $obj = Bio::PrimarySeq->new(-id => 'internalbioperlseq',-seq => $scalar); } return $obj->revcom();
}
revcomdescriptionprevnextTop
sub revcom {
    return &Bio::Perl::reverse_complement(@_);
}
reverse_complement_as_stringdescriptionprevnextTop
sub reverse_complement_as_string {
   my ($scalar) = shift;

   my $obj = &Bio::Perl::reverse_complement($scalar);

   return $obj->seq;
}
revcom_as_stringdescriptionprevnextTop
sub revcom_as_string {
   my ($scalar) = shift;

   my $obj = &Bio::Perl::reverse_complement($scalar);

   return $obj->seq;
}


1;
}
General documentation
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org
Support Top
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the web:
  https://redmine.open-bio.org/projects/bioperl/
AUTHOR - Ewan BirneyTop
Email birney@ebi.ac.uk
APPENDIXTop
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _