Bio::Seq PrimedSeq
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it
Package variables
No package variables defined.
Included modules
Bio::Root::Root Bio::SeqFeature::Generic
  use Bio::Seq;
use Bio::Seq::PrimedSeq;
my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' ); my $left = Bio::Seq->new( -seq => 'AGCT' ); my $right = Bio::Seq->new( -seq => 'GTTGC' ); my $primedseq = Bio::Seq::PrimedSeq->new( -seq => $template, # sequence object -left_primer => $left, # sequence or primer object -right_primer => $right # sequence or primer object ); # Get the primers as Bio::SeqFeature::Primer objects my @primer_objects = $primedseq->get_primer(); # Sequence object representing the PCR product, i.e. the section of the target # sequence contained between the primers (primers included) my $amplicon_seq = $primedseq->amplicon(); print 'Got amplicon sequence: '.$amplicon_seq->seq."\n"; # Amplicon should be: agctTTTCATTCTGACTgcaac
This module was created to address the fact that a primer is more than a
SeqFeature and that there is a need to represent the primer-sequence complex and
the attributes that are associated with the complex.
A PrimedSeq object is initialized with a target sequence and two primers. The
location of the primers on the target sequence is calculated if needed so that
one can then get the PCR product, or amplicon sequence. From the PrimedSeq object
you can also retrieve information about melting temperatures and what not on each
of the primers and the amplicon. The Bio::Tools::Primer3 module uses PrimedSeq
objects extensively.
Note that this module does not simulate PCR. It assumes that the primers
will match in a single location on the target sequence and does not understand
degenerate primers.
    Providing primers as sequence objects
    If the primers are specified as sequence objects, e.g. Bio::PrimarySeq or
Bio::Seq, they are first converted to Bio::SeqFeature::Primer objects.
Their location on the target sequence is then calculated and added to the
Bio::SeqFeature::Primer objects, which you can retrieve using the get_primer()
    Providing primers as primer objects
    Because of the limitations of specifying primers as sequence objects, the
recommended method is to provide Bio::SeqFeature::Primer objects. If you did
not record the location of the primers in the primer object, it will be
Bio::Seq::PrimedSeq was initially started by Chad Matsalla, and later
improved on by Rob Edwards.
Methods description
newcode    nextTop
 Title   : new()
Usage : my $primedseq = Bio::SeqFeature::Primer->new(
-seq => $sequence,
-left_primer => $left_primer,
-right_primer => $right_primer
Function: Construct a primed sequence.
Returns : A Bio::Seq::PrimedSeq object
Args : -seq => a Bio::Seq object (required)
-left_primer => a Bio::SeqFeature::Primer or sequence object (required)
-right_primer => a Bio::SeqFeature::Primer or sequence object (required)
If you pass a sequence object to specify a primer, it will be used to construct a Bio::SeqFeature::Primer that you can retrieve with the get_primer method.
Many other parameters can be included including all of the output parameters from the primer3 program (see Bio::Tools::Primer3). At
the moment these parameters will simply be stored and do anything.
 Title   : get_primer();
Usage : my @primers = $primedseq->get_primer();
my $primer = $primedseq->get_primer('-left_primer');
Function: Get the primers associated with the PrimedSeq object.
Returns : A Bio::SeqFeature::Primer object
Args : For the left primer, use: l, left, left_primer or -left_primer
For the right primer, use: r, right, right_primer or -right_primer
For both primers [default], use: b, both, both_primers or -both_primers
 Title   : annotated_sequence
Usage : my $annotated_sequence_object = $primedseq->annotate_sequence();
Function: Get an annotated sequence object containg the left and right
Returns : An annotated sequence object or 0 if not defined.
Args :
Note : Use this method to return a sequence object that you can write
out (e.g. in GenBank format). See the example above.
 Title   : amplicon
Usage : my $amplicon = $primedseq->amplicon();
Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
only the section of the target sequence between the primer matches
(primers included).
Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
Args : None
Note :
 Title   : seq
Usage : my $seqobj = $primedseq->seq();
Function: Retrieve the target sequence as a sequence object
Returns : A seq object. To get the sequence use $seqobj->seq
Args : None
Note :
 Title   : _place_primers
Usage : $self->_place_primers();
Function: An internal method to place the primers on the sequence and
set up the ranges of the sequences
Returns : Nothing
Args : None
Note : Internal use only
Methods code
sub new {
    my($class,%args) = @_;
    my $self = $class->SUPER::new(%args);

    # Need an amplicon sequence
$self->{seq} = delete $args{-seq} || delete $args{-target_sequence} || $self->throw("Need to provide a sequence during PrimedSeq object construction"); if (! ref($self->{seq}) || ! $self->{seq}->isa('Bio::SeqI') ) { $self->throw("The target_sequence must be a Bio::Seq to create this object."); } # Need a left and right primers
for my $primer ( 'left', 'right' ) { $self->{$primer} = delete $args{'-'.$primer.'_primer'} || $self->throw("Need to provide both primers during PrimedSeq object construction"); if ( ref $self->{$primer} && $self->{$primer}->isa('Bio::PrimarySeqI') ) { # Convert Bio::Seq or Bio::PrimarySeq objects to Bio::SeqFeature::Primer
$self->{$primer} = Bio::SeqFeature::Primer->new(-seq => $self->{$primer}); } if (not (ref $self->{$primer} && $self->{$primer}->isa("Bio::SeqFeature::Primer"))) { $self->throw("Primers must be Bio::SeqFeature::Primer objects but got a ".ref($self->{$primer})); } } # Save remaining arguments
while (my ($arg, $val) = each %args) { $self->{$arg} = $val; } # Determine primer location on target if needed
if ( not( $self->{'left'}->start && $self->{'left'}->end && $self->{'right'}->start && $self->{'right'}->end ) ) { $self->_place_primers(); } return $self;
sub get_primer {
    my ($self, $arg) = @_;
    if (! defined $arg ) {
        return ($self->{left}, $self->{right});
    } elsif ( $arg =~ /^-?l/ ) {
        # What a cheat, I couldn't be bothered to write all the exact statements!
# Hah, now you can write 'leprechaun' to get the left primer.
return $self->{left} } elsif ( $arg =~ /^-?r/ ) { return $self->{right}; } elsif ( $arg =~ /^-?b/ ) { return ($self->{left}, $self->{right}); }
sub annotated_sequence {
    my $self = shift;
    my $seq = $self->{'seq'}; ### clone??
$seq->add_SeqFeature($self->{'left'}); $seq->add_SeqFeature($self->{'right'}); return $seq;
sub amplicon {
    my ($self) = @_;
    my $left   = $self->{left};
    my $right  = $self->{right};
    my $target = $self->{seq};
    return Bio::PrimarySeq->new(
        -id  => 'Amplicon_from_'.($target->id || 'unidentified'),
        -seq => lc( $left->seq->seq ).
                uc( $target->subseq($left->end+1, $right->start-1) ).
                lc( $right->seq->revcom->seq ),
sub seq {
    my $self = shift;
    return $self->{seq};
sub _place_primers {
    my $self = shift;

    # Get the target and primer sequence strings, all in uppercase
my $left = $self->{left}; my $right = $self->{right}; my $target_seq = uc $self->{seq}->seq(); my $left_seq = uc $left->seq()->seq(); my $right_seq = uc $right->seq()->revcom()->seq(); # Locate primers on target sequence
my ($before, $middle, $after) = ($target_seq =~ /^(.*)$left_seq(.*)$right_seq(.*)$/); if (not defined $before || not defined $middle || not defined $after) { if ($target_seq !~ /$left_seq/) { $self->throw("Could not place left primer on target"); } if ($target_seq !~ /$right_seq/) { $self->throw("Could not place right primer on target") } } # Save location information in primer object
my $left_location = length($before) + 1; my $right_location = length($target_seq) - length($after); $left->start($left_location); $left->end($left_location + $left->seq->length - 1); $left->strand(1); $right->start($right_location - $right->seq->length + 1); $right->end($right_location); $right->strand(-1); # If Primer3 information was recorded, compare it to what we calculated
if ( exists($left->{PRIMER_LEFT}) || exists($right->{PRIMER_RIGHT}) || exists($self->{PRIMER_PRODUCT_SIZE}) ) { # Bio::Seq::PrimedSeq positions
my $amplicon_size = length($left_seq) + length($middle) + length($right_seq); $left_location = $left_location.','.length($left_seq); $right_location = $right_location.','.length($right_seq); # Primer3 positions
my $primer_product = $self->{PRIMER_PRODUCT_SIZE}; my $primer_left = $left->{PRIMER_LEFT}; my $primer_right = $right->{PRIMER_RIGHT}; if ( defined($primer_left) && (not $primer_left eq $left_location) ) { $self->warn("Got |$primer_left| from primer3 but calculated ". "|$left_location| for the left primer."); } if ( defined($primer_right) && (not $primer_right eq $right_location) ) { $self->warn("Got |$primer_right| from primer3 but calculated ". "|$right_location| for the right primer."); } if ( defined($primer_product) && (not $primer_product eq $amplicon_size) ) { $self->warn("Got |$primer_product| from primer3 but calculated ". "|$amplicon_size| for the size."); } } } 1;
General documentation
    Run Primer3 to get PrimedSeq objects:
  use Bio::SeqIO;
use Bio::Tools::Run::Primer3;
# Read a target sequences from a FASTA file my $file = shift || die "Need a file to read"; my $seqin = Bio::SeqIO->new(-file => $file); my $seq = $seqin->next_seq; # Use Primer3 to design some primers my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq); my $results = $primer3->run; # default parameters # Write all the results in a Genbank file my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", -format => 'genbank'); while (my $primedseq = $results->next_primer) { $seqout->write_seq( $primedseq->annotated_seq ); }
    Create a genbank file for a sequence and its cognate primers:
  use Bio::SeqIO;
use Bio::Seq::PrimedSeq;
# Read a FASTA file that contains the target sequence and its two primers my $file = shift || die "$0 "; my $seqin = Bio::SeqIO->new(-file => $file); my ($template, $leftprimer, $rightprimer) = ($seqin->next_seq, $seqin->next_seq, $seqin->next_seq); # Set up a PrimedSeq object my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template, -left_primer => $leftprimer, -right_primer => $rightprimer); # Write the sequences in an output Genbank file my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", -format => 'genbank'); $seqout->write_seq($primedseq->annotated_sequence);
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.                  - General discussion - About the mailing lists
Support Top
Please direct usage questions or support issues to the mailing list:
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
Rob Edwards,
Based on a module written by Chad Matsalla,
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _