Bio::SeqFeature Primer
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Toolbar
WebCvs
Summary
Bio::SeqFeature::Primer - Primer Generic SeqFeature
Package variables
No package variables defined.
Included modules
Bio::PrimarySeq
Bio::Tools::SeqStats
Inherit
Bio::SeqFeature::SubSeq
Synopsis
  use Bio::SeqFeature::Primer;
# Primer object with explicitly-defined sequence object or sequence string my $primer = Bio::SeqFeature::Primer->new( -seq => 'ACGTAGCT' ); $primer->display_name('test_id'); print "These are the details of the primer:\n". "Name: ".$primer->display_name."\n". "Tag: ".$primer->primary_tag."\n". # always 'Primer' "Sequence: ".$primer->seq->seq."\n". "Tm: ".$primer->Tm."\n\n"; # melting temperature # Primer object with implicit sequence object # It is a lighter approach for when the primer location on a template is known use Bio::Seq; my $template = Bio::Seq->new( -seq => 'ACGTAGCTCTTTTCATTCTGACTGCAACG' ); $primer = Bio::SeqFeature::Primer->new( -start => 1, -end =>5, -strand => 1 ); $template->add_SeqFeature($primer); print "Primer sequence is: ".$primer->seq->seq."\n"; # Primer sequence is 'ACGTA'
Description
This module handles PCR primer sequences. The Bio::SeqFeature::Primer object
is a Bio::SeqFeature::Subseq object that can additionally contain a primer
sequence and its coordinates on a template sequence. The primary_tag() for this
object is 'Primer'. A method is provided to calculate the melting temperature Tm
of the primer. Bio::SeqFeature::Primer objects are useful to build
Bio::Seq::PrimedSeq amplicon objects such as the ones returned by
Bio::Tools::Primer3.
Methods
newDescriptionCode
location
No description
Code
TmDescriptionCode
Tm_estimateDescriptionCode
Methods description
new()code    nextTop
 Title   : new()
Usage : my $primer = Bio::SeqFeature::Primer( -seq => $seq_object );
Function: Instantiate a new Bio::SeqFeature::Primer object
Returns : A Bio::SeqFeature::Primer object
Args : -seq , a sequence object or a sequence string (optional)
-id , the ID to give to the primer sequence, not feature (optional)
Tm()codeprevnextTop
 Title   : Tm()
Usage : my $tm = $primer->Tm(-salt => 0.05, -oligo => 0.0000001);
Function: Calculate the Tm (melting temperature) of the primer
Returns : A scalar containing the Tm.
Args : -salt : set the Na+ concentration on which to base the calculation
(default=0.05 molar).
: -oligo : set the oligo concentration on which to base the
calculation (default=0.00000025 molar).
Notes : Calculation of Tm as per Allawi et. al Biochemistry 1997
36:10581-10594. Also see documentation at
http://www.idtdna.com/Scitools/Scitools.aspx as they use this
formula and have a couple nice help pages. These Tm values will be
about are about 0.5-3 degrees off from those of the idtdna web tool.
I don't know why.
This was suggested by Barry Moore (thanks!). See the discussion on the bioperl-l with the subject "Bio::SeqFeature::Primer Calculating the PrimerTM"
Tm_estimatecodeprevnextTop
 Title   : Tm_estimate
Usage : my $tm = $primer->Tm_estimate(-salt => 0.05);
Function: Estimate the Tm (melting temperature) of the primer
Returns : A scalar containing the Tm.
Args : -salt set the Na+ concentration on which to base the calculation.
Notes : This is only an estimate of the Tm that is kept in for comparative
reasons. You should probably use Tm instead!
This Tm calculations are taken from the Primer3 docs: They are based on Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length where [Na+] is the molar sodium concentration, %GC is the %G+C of the sequence, and length is the length of the sequence. However.... I can never get this calculation to give me the same result as primer3 does. Don't ask why, I never figured it out. But I did want to include a Tm calculation here because I use these modules for other things besides reading primer3 output. The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM' and this calculation is saved as $primer->Tm so you can get both and average them!
Methods code
newdescriptionprevnextTop
sub new {
    my ($class, %args) = @_;

    # Legacy stuff
my $sequence = delete $args{-sequence}; if ($sequence) { Bio::Root::Root->deprecated( -message => 'Creating a Bio::SeqFeature::Primer with -sequence is deprecated. Use -seq instead.', -warn_version => '1.006', -throw_version => '1.008', ); $args{-seq} = $sequence; } # Initialize Primer object
my $self = $class->SUPER::new(%args); my ($id) = $self->_rearrange([qw(ID)], %args); $id && $self->seq->id($id); $self->primary_tag('Primer'); return $self; } # Bypass B::SF::Generic's location() when a string is passed (for compatibility)
}
locationdescriptionprevnextTop
sub location {
    my ($self, $location) = @_;
    if ($location) {
        if ( not ref $location ) {
            # Use location as a string for backward compatibility
Bio::Root::Root->deprecated( -message => 'Passing a string to location() is deprecated. Pass a Bio::Location::Simple object or use start() and end() instead.', -warn_version => '1.006', -throw_version => '1.008', ); $self->{'_location'} = $location; } else { $self->SUPER::location($location); } } return $self->SUPER::location;
}
TmdescriptionprevnextTop
sub Tm {
    my ($self, %args) = @_;
    my $salt_conc = 0.05; # salt concentration (molar units)
my $oligo_conc = 0.00000025; # oligo concentration (molar units)
if ($args{'-salt'}) { # Accept object defined salt concentration
$salt_conc = $args{'-salt'}; } if ($args{'-oligo'}) { # Accept object defined oligo concentration
$oligo_conc = $args{'-oligo'}; } my $seqobj = $self->seq(); my $length = $seqobj->length(); my $sequence = uc $seqobj->seq(); my @dinucleotides; my $enthalpy; my $entropy; # Break sequence string into an array of all possible dinucleotides
while ($sequence =~ /(.)(?=(.))/g) { push @dinucleotides, $1.$2; } # Build a hash with the thermodynamic values
my %thermo_values = ('AA' => {'enthalpy' => -7.9, 'entropy' => -22.2}, 'AC' => {'enthalpy' => -8.4, 'entropy' => -22.4}, 'AG' => {'enthalpy' => -7.8, 'entropy' => -21}, 'AT' => {'enthalpy' => -7.2, 'entropy' => -20.4}, 'CA' => {'enthalpy' => -8.5, 'entropy' => -22.7}, 'CC' => {'enthalpy' => -8, 'entropy' => -19.9}, 'CG' => {'enthalpy' => -10.6, 'entropy' => -27.2}, 'CT' => {'enthalpy' => -7.8, 'entropy' => -21}, 'GA' => {'enthalpy' => -8.2, 'entropy' => -22.2}, 'GC' => {'enthalpy' => -9.8, 'entropy' => -24.4}, 'GG' => {'enthalpy' => -8, 'entropy' => -19.9}, 'GT' => {'enthalpy' => -8.4, 'entropy' => -22.4}, 'TA' => {'enthalpy' => -7.2, 'entropy' => -21.3}, 'TC' => {'enthalpy' => -8.2, 'entropy' => -22.2}, 'TG' => {'enthalpy' => -8.5, 'entropy' => -22.7}, 'TT' => {'enthalpy' => -7.9, 'entropy' => -22.2}, 'A' => {'enthalpy' => 2.3, 'entropy' => 4.1}, 'C' => {'enthalpy' => 0.1, 'entropy' => -2.8}, 'G' => {'enthalpy' => 0.1, 'entropy' => -2.8}, 'T' => {'enthalpy' => 2.3, 'entropy' => 4.1} ); # Loop through dinucleotides and calculate cumulative enthalpy and entropy values
for (@dinucleotides) { $enthalpy += $thermo_values{$_}{enthalpy}; $entropy += $thermo_values{$_}{entropy}; } # Account for initiation parameters
$enthalpy += $thermo_values{substr($sequence, 0, 1)}{enthalpy}; $entropy += $thermo_values{substr($sequence, 0, 1)}{entropy}; $enthalpy += $thermo_values{substr($sequence, -1, 1)}{enthalpy}; $entropy += $thermo_values{substr($sequence, -1, 1)}{entropy}; # Symmetry correction
$entropy -= 1.4; my $r = 1.987; # molar gas constant
my $tm = $enthalpy * 1000 / ($entropy + ($r * log($oligo_conc))) - 273.15 + (12* (log($salt_conc)/log(10))); return $tm;
}
Tm_estimatedescriptionprevnextTop
sub Tm_estimate {
    # This should probably be put into seqstats as it is more generic, but what the heck.
my ($self, %args) = @_; my $salt = 0.2; if ($args{'-salt'}) { $salt = $args{'-salt'} }; my $seqobj = $self->seq(); my $length = $seqobj->length(); my $seqdata = Bio::Tools::SeqStats->count_monomers($seqobj); my $gc=$$seqdata{'G'} + $$seqdata{'C'}; my $percent_gc = ($gc/$length)*100;
my $tm = 81.5+(16.6*(log($salt)/log(10)))+(0.41*$percent_gc) - (600/$length); return $tm;
}
General documentation
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support Top
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
  https://redmine.open-bio.org/projects/bioperl/
AUTHOR Top
Rob Edwards, redwards@utmem.edu
The original concept and much of the code was written by
Chad Matsalla, bioinformatics1@dieselwurks.com
APPENDIXTop
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _
primary_tag, source_tag, location, start, end, strand...Top
The documentation of Bio::SeqFeature::Generic describes all the methods that
Bio::SeqFeature::Primer object inherit.