Bio::Tools::Analysis::DNA ESEfinder
SummaryIncluded librariesPackage variablesSynopsisDescriptionGeneral documentationMethods
Toolbar
WebCvs
Summary
Bio::Tools::Analysis::DNA::ESEfinder - a wrapper around ESEfinder
server
Package variables
Privates (from "my" definitions)
$ANALYSIS_SPEC = { 'name' => 'ESEfinder', 'type' => 'DNA', 'version' => '2.0', 'supplier' => 'Krainer lab, Cold Spring Harbor Laboratory, POBOX100, Bungtown Rd, COld Spring Harbor, NY, USA', 'description' => 'to identify exonic splicing elements in human transcripts', }
$URL = 'http://rulai.cshl.org/cgi-bin/tools/ESE/esefinder.cgi'
$ANALYSIS_NAME = 'ESEfinder'
$INPUT_SPEC = [{ 'mandatory' => 'true', 'type' => 'Bio::PrimarySeqI', 'name' => 'sequence', }]
$RESULT_SPEC = { '' => 'bulk', 'Bio::SeqFeatureI' => 'ARRAY of Bio::SeqFeature::Generic', 'raw' => 'Array of [ SR_protein, position, motif, score]', 'all' => 'Bio::Seq::Meta::Array object' }
Included modules
Bio::Seq::Meta::Array
Bio::SeqFeature::Generic
Bio::SeqIO
Bio::WebAgent
Data::Dumper
HTML::HeadParser
HTTP::Request::Common qw ( POST )
IO::String
strict
Inherit
Bio::Tools::Analysis::SimpleAnalysisBase
Synopsis
  use Bio::Tools::Analysis::DNA::ESEfinder;
use strict;
my $seq; # a Bio::PrimarySeqI or Bio::SeqI object $seq = Bio::Seq->new( -primary_id => 'test', -seq=>'atgcatgctaggtgtgtgttttgtgggttgtactagctagtgat'. -alphabet=>'dna'); my $ese_finder = Bio::Tools::Analysis::DNA::ESEfinder-> new(-seq => $seq); # run ESEfinder prediction on a DNA sequence $ese_finder->run(); die "Could not get a result" unless $ese_finder->status =~ /^COMPLETED/; print $ese_finder->result; # print raw prediction to STDOUT foreach my $feat ( $ese_finder->result('Bio::SeqFeatureI') ) { # do something to SeqFeature # e.g. print as GFF print $feat->gff_string, "\n"; # or store within the sequence - if it is a Bio::SeqI $seq->add_SeqFeature($feat) }
Description
This class is a wrapper around the ESEfinder web server which uses
experimentally defined scoring matrices to identify possible exonic
splicing enhancers in human transcripts.
The results can be retrieved in 4 ways.
    1.
$ese_finder-E<gt>result('') retrieves the raw text output of the
program
    2.
$ese_finder-E<gt>result('all') returns a Bio::Seq::Meta::Array object
with prediction scores for all residues in the sequence
    3.
$ese_finder-E<gt>result('Bio::SeqFeatureI') returns an array of
Bio::SeqFeature objects for sequences with significant scores. Feature
tags are score, motif, SR_protein and method
    4.
$ese_finder-E<gt>result('raw') returns an array of significant matches
with each element being a reference to [SR_protein, position, motif,
score]
See http://rulai.cshl.edu/tools/ESE2/
This the second implentation of Bio::SimpleAnalysisI which hopefully
will make it easier to write wrappers on various services. This class
uses a web resource and therefore inherits from Bio::WebAgent.
Methods
_init
No description
Code
_run
No description
Code
result
No description
Code
Methods description
None available.
Methods code
_initdescriptionprevnextTop
sub _init {
    ## fills in fixed data for class ##
my $self = shift; $self->url($URL); $self->{'_ANALYSIS_SPEC'} =$ANALYSIS_SPEC; $self->{'_INPUT_SPEC'} =$INPUT_SPEC; $self->{'_RESULT_SPEC'} =$RESULT_SPEC; $self->{'_ANALYSIS_NAME'} =$ANALYSIS_NAME; return $self;
}
_rundescriptionprevnextTop
sub _run {
    my $self  = shift;
    my $seq_fasta;
    my $stringfh = new IO::String($seq_fasta);
    my $seqout = Bio::SeqIO->new(-fh => $stringfh,
                                -format => 'fasta');
    $seqout->write_seq($self->seq);
    $self->debug($seq_fasta);
    $self->delay(1);
    # delay repeated calls by default by 3 sec, set delay() to change
$self->sleep; $self->status('TERMINATED_BY_ERROR'); my $request = POST $self->url, #Content_Type => 'x-www-form-urlencoded',
Content => [ protein1 => 1, protein2 => 1, protein3 => 1, protein4 => 1, radio_sf2 => 0, radio_sc35 => 0, radio_srp40 => 0, radio_srp55 => 0, sequence =>$seq_fasta, ]; my $content = $self->request($request); if( $content->is_error ) { $self->throw(ref($self)." Request Error:\n".$content->as_string); } my $text = $content->content; #1st reponse
my ($tmpfile) = $text =~ /value="(tmp\/.+txt)"/; # now get data for all residues #
my $rq2 = POST 'http://rulai.cshl.org/cgi-bin/tools/ESE/resultfile.txt', #Content_Type => 'x-www-form-urlencoded',
Content => [ fname => $tmpfile, ]; my $ua2 = Bio::WebAgent->new(); my $content2 = $ua2->request($rq2); if( $content2->is_error ) { $self->throw(ref($self)." Request Error:\n".$content2->as_string); } my $text2 = $content2->content; $self->{'_result'} = $text2; $self->status('COMPLETED') if $text2 ne ''; #print Dumper $response;
}
resultdescriptionprevnextTop
sub result {
    #make sec feat of above threshold scores #
my ($self,$value) = @_; my @sig_pdctns; my @fts; if ($value ) { my $result = IO::String->new($self->{'_result'}); my $current_SR; my $all_st_flag = 0; my %all; while (my $line = <$result>) { #make array of all scores or threshold depending on $value
last if $line =~ /^All scores/ && $value ne 'all' or $line =~ /2001,/; $all_st_flag++ if $line =~ /All scores/; next if $value eq 'all' && $all_st_flag == 0; #parse line
if ($line =~ /^Protein/) { ($current_SR) = $line =~/:\s+(\S+)/; $current_SR =~ s{/}{_}; # remove unallowed charcters from hash
} if ( $line =~/^\d+/ && $value ne 'all') { push @sig_pdctns, [$current_SR, split /\s+/, $line] ; } elsif ($line =~ /^\d+/) { push @{$all{$current_SR}}, [split /\s+/, $line]; } } if ($value eq 'Bio::SeqFeatureI') { foreach (@sig_pdctns) { #make new ese object for each row of results
push @fts, Bio::SeqFeature::Generic->new ( -start => $_->[1], -end => $_->[1] + length($_->[2]) -1, -source => 'ESEfinder', -primary => 'ESE', -tag =>{ score =>$_->[3], motif=> $_->[2], SR_protein=> $_->[0], method=> 'ESEfinder', }, ); } return @fts; } ## convert parsed data into a meta array format
elsif ($value eq 'all') { bless ($self->seq, "Bio::Seq::Meta::Array"); $self->seq->isa("Bio::Seq::MetaI") || $self->throw("$self is not a Bio::Seq::MetaI"); for my $prot (keys %all) { my @meta; my $len = scalar @{$all{$prot}} ; for (my $i = 0; $i < $len; $i++ ) { $meta[$i] = $all{$prot}[$i][2]; } # assign default name here so that the
# Bio::Seq::Meta::Array can work for all classes
# implementing it and we can avoid having to make
# asubclass for each implementation
$Bio::Seq::Meta::Array::DEFAULT_NAME = "ESEfinder_SRp55"; my $meta_name = $self->analysis_spec->{'name'} . "_" . "$prot"; $self->seq->named_meta($meta_name,\@meta ); } # return seq array object implementing meta sequence #
return $self->seq; } #return ref to array of arrays
return\@ sig_pdctns; } return $self->{'_result'}; } 1;
}
General documentation
SEE ALSOTop
Bio::SimpleAnalysisI,
Bio::WebAgent
FEEDBACKTop
Mailing ListsTop
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists. Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Support Top
Please direct usage questions or support issues to the mailing list:
bioperl-l@bioperl.org
rather than to the module maintainer directly. Many experienced and
reponsive experts will be able look at the problem and quickly
address it. Please include a thorough description of the problem
with code and data examples if at all possible.
Reporting BugsTop
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution. Bug reports can be submitted via the
web:
  https://redmine.open-bio.org/projects/bioperl/
AUTHORSTop
Richard Adams, Richard.Adams@ed.ac.uk,
Heikki Lehvaslaiho, heikki-at-bioperl-dot-org
APPENDIXTop
The rest of the documentation details each of the object
methods. Internal methods are usually preceded with a _