This DESCRIPTION only documents Bio::Tools::Run::StandAloneBlast: - a
Bioperl object for running the NCBI standAlone BLAST package. Blast
itself, is a large & complex program - for more information regarding
BLAST, please see the BLAST documentation which accompanies the BLAST
distribution. BLAST is available from
ftp://ncbi.nlm.nih.gov/blast/.
A source of confusion in documenting a BLAST interface is that the
term "program" is used in - at least - three different ways in the
BLAST documentation. In this DESCRIPTION, "program" will refer to the
BLAST routine set by the BLAST -p parameter that can be set to blastn,
blastp, tblastx etc. We will use the term Blast "executable" to refer
to the various different executable files that may be called - ie.
blastall, blastpgp or bl2seq. In addition, there are several BLAST
capabilities, which are also referred to as "programs", and are
implemented by using specific combinations of BLAST executables,
programs and parameters. They will be referred by their specific
names - eg PSIBLAST and PHIBLAST.
Before running StandAloneBlast it is necessary: to install BLAST
on your system, to edit set the environmental variable $BLASTDIR
or your $PATH variable to point to the BLAST directory, and to
ensure that users have execute privileges for the BLAST program.
If the databases which will be searched by BLAST are located in the
data subdirectory of the blast program directory (the default
installation location), StandAloneBlast will find them; however,
if the database files are located in any other location, environmental
variable $BLASTDATADIR will need to be set to point to that directory.
The use of the StandAloneBlast module is as follows: Initially, a
local blast "factory object" is created. The constructor may be passed
an optional array of (non-default) parameters to be used by the
factory, eg:
@params = (-program => 'blastn', -database => 'ecoli.nt');
$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
Any parameters not explicitly set will remain as the defaults of the
BLAST executable. Note each BLAST executable has somewhat different
parameters and options. See the BLAST Documentation for a description
or run the BLAST executable from the command line followed solely with
a "-" to see a list of options and default values for that executable;
eg >blastall -.
BLAST parameters can be changed and/or examined at any time after the
factory has been created. The program checks that any
parameter/switch being set/read is valid. Except where specifically
noted, StandAloneBlast uses the same single-letter, case-sensitive
parameter names as the actual blast program. Currently no checks are
included to verify that parameters are of the proper type (e.g. string
or numeric) or that their values are within the proper range.
As an example, to change the value of the Blast parameter 'e' ('e' is
the parameter for expectation-value cutoff)
$expectvalue = 0.01;
$factory->e($expectvalue);
Note that for improved script readibility one can modify the name of
the (ncbi) BLAST parameters as desired as long as the initial letter (and
case) of the parameter are preserved, e.g.:
$factory->expectvalue($expectvalue);
Unfortunately, some of the BLAST parameters are not the single
letter one might expect (eg "iteration round" in blastpgp is 'j').
Again one can check by using, for example:
> blastpgp -
Wublast parameters need to be complete (ie. don't truncate them to their
first letter), but are case-insensitive.
Once the factory has been created and the appropriate parameters set,
one can call one of the supported blast executables. The input
sequence(s) to these executables may be fasta file(s) as described in
the BLAST documentation.
$inputfilename = 't/testquery.fa';
$blast_report = $factory->blastall($inputfilename);
In addition, sequence input may be in the form of either a Bio::Seq
object or (a reference to) an array of Bio::Seq objects, e.g.:
$input = Bio::Seq->new(-id => "test query",
-seq => "ACTACCCTTTAAATCAGTGGGGG");
$blast_report = $factory->blastall($input);
NOTE: Use of the BPlite method has been deprecated and is no longer supported.
For blastall and non-psiblast blastpgp runs, report object is a
Bio::SearchIOobject, selected by the user with the parameter _READMETHOD. The leading
underscore is needed to distinguish this option from options which are passed to
the BLAST executable. The default parser is Bio::SearchIO::blast. In any case,
the "raw" blast report is also available. The filename is set by the 'outfile'
parameter and has the default value of "blastreport.out".
For psiblast execution in the BLAST "jumpstart" mode, the program must
be passed (in addition to the query sequence itself) an alignment
containing the query sequence (in the form of a SimpleAlign object) as
well as a "mask" specifying at what residues position-specific scoring
matrices (PSSMs) are to used and at what residues default scoring
matrices (eg BLOSUM) are to be used. See psiblast documentation for
more details. The mask itself is a string of 0's and 1's which is the
same length as each sequence in the alignment and has a "1" at
locations where (PSSMs) are to be used and a "0" at all other
locations. So for example:
$str = Bio::AlignIO->new(-file => "cysprot.msf",
-format => 'msf');
$aln = $str->next_aln();
$len = $aln->length_aln();
$mask = '1' x $len;
# simple case where PSSM's to be used at all residues
$report = $factory->blastpgp("cysprot1.fa", $aln, $mask);
For bl2seq execution, StandAloneBlast.pm can be combined with
AlignIO.pm to directly produce a SimpleAlign object from the alignment
of the two sequences produced by bl2seq as in:
# Get 2 sequences
$str = Bio::SeqIO->new(-file=>'t/amino.fa' , -format => 'Fasta');
my $seq3 = $str->next_seq();
my $seq4 = $str->next_seq();
# Run bl2seq on them
$factory = Bio::Tools::Run::StandAloneBlast->new(-program => 'blastp',
-outfile => 'bl2seq.out');
my $bl2seq_report = $factory->bl2seq($seq3, $seq4);
# Use AlignIO.pm to create a SimpleAlign object from the bl2seq report
$str = Bio::AlignIO->new(-file=> 'bl2seq.out',-format => 'bl2seq');
$aln = $str->next_aln();
For more examples of syntax and use of StandAloneBlast.pm, the user is
encouraged to run the scripts standaloneblast.pl in the bioperl
examples/tools directory and StandAloneBlast.t in the bioperl t/
directory.